ID: 909390639

View in Genome Browser
Species Human (GRCh38)
Location 1:75117095-75117117
Sequence GACCCATTTGTTATTCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909390638_909390639 -1 Left 909390638 1:75117073-75117095 CCTTCTAGGTTAGGCAGTCTCTG No data
Right 909390639 1:75117095-75117117 GACCCATTTGTTATTCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909390639 Original CRISPR GACCCATTTGTTATTCAACC AGG Intergenic
No off target data available for this crispr