ID: 909395493

View in Genome Browser
Species Human (GRCh38)
Location 1:75167034-75167056
Sequence TCTCAGATTAGAACACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909395493_909395497 26 Left 909395493 1:75167034-75167056 CCTGCTTGTGTTCTAATCTGAGA No data
Right 909395497 1:75167083-75167105 TAGTTTATTCTGCTCTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909395493 Original CRISPR TCTCAGATTAGAACACAAGC AGG (reversed) Intergenic
No off target data available for this crispr