ID: 909400831

View in Genome Browser
Species Human (GRCh38)
Location 1:75228179-75228201
Sequence TATTAGGTATAAACCTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909400831 Original CRISPR TATTAGGTATAAACCTTAGG AGG (reversed) Intronic
901592067 1:10352635-10352657 TATTCGGAATAAGCCTGAGGTGG + Exonic
906007350 1:42487364-42487386 TATTAGGTGAAAATCTAAGGTGG + Intronic
907847940 1:58226701-58226723 TCTTTTGTATAATCCTTAGGAGG + Intronic
909400831 1:75228179-75228201 TATTAGGTATAAACCTTAGGAGG - Intronic
909507771 1:76413544-76413566 GATTACTTAAAAACCTTAGGTGG + Intronic
910121487 1:83795219-83795241 TATTAGGAAGAATTCTTAGGAGG + Intergenic
913038442 1:114998759-114998781 TATTAGTTATAAATTTTTGGGGG - Intergenic
915640705 1:157223197-157223219 TCTTAGGAATAAACTTAAGGAGG - Intergenic
915792061 1:158683282-158683304 TATGAGATATAAACCTTGAGTGG - Intronic
916839710 1:168587052-168587074 TAGTAGGTAGAAACTTTAGGTGG - Intergenic
916989558 1:170227627-170227649 AAAAAGGCATAAACCTTAGGTGG + Intergenic
917728261 1:177848301-177848323 AATTAGCCATAAGCCTTAGGAGG + Intergenic
918790304 1:188816708-188816730 TATTGGGTATAAAGCTTAGTAGG + Intergenic
924576480 1:245285286-245285308 CATCAGGTCTAGACCTTAGGAGG - Intronic
1064191558 10:13210675-13210697 TATTAGGACATAACCTTAGGAGG - Intronic
1067410412 10:46059634-46059656 TATTAGGCAGAAACTTAAGGGGG + Intergenic
1067491313 10:46706605-46706627 TGTTAGGTATAAATCTAAAGTGG + Intergenic
1067603351 10:47633773-47633795 TGTTAGGTATAAATCTAAAGTGG - Intergenic
1068564492 10:58558077-58558099 TATCAGGTAGAAAACTTAGAAGG - Intronic
1068897124 10:62218041-62218063 TATCAGATATAAACTGTAGGGGG - Intronic
1069190744 10:65485203-65485225 TTATAGTTATAGACCTTAGGAGG - Intergenic
1078247560 11:9589425-9589447 AATCAAGTATAAAACTTAGGGGG - Intronic
1078386504 11:10897722-10897744 TATTATGCATAAACCTTACAAGG + Intergenic
1079513619 11:21240365-21240387 TATTAGTTATAATCCTGAAGTGG + Intronic
1079786283 11:24677088-24677110 TATTTGATATATACATTAGGAGG - Intronic
1081199936 11:40203568-40203590 CATTAGGTAGAAACATTTGGTGG - Intronic
1083070384 11:59972901-59972923 TATTAGGTATCACCAATAGGTGG + Intergenic
1083503586 11:63134018-63134040 TATTTTGTATAACCCTTATGTGG + Intronic
1085385405 11:76154808-76154830 AATCAGGTTTCAACCTTAGGGGG + Intergenic
1103299102 12:119914045-119914067 TGTTAGGTAAAAACTTTGGGCGG + Intergenic
1103514744 12:121500294-121500316 TGTAAGGTGTAACCCTTAGGGGG - Intronic
1107319644 13:39171931-39171953 TCTTAGGAATAAACCTTCAGTGG - Intergenic
1112143166 13:96669180-96669202 TCTTAGGTATAAACCCTATATGG + Intronic
1112820935 13:103334283-103334305 TATTAGGGATATTCCTTAGTGGG + Intergenic
1115088206 14:29542648-29542670 AATTAGGGATATACTTTAGGAGG - Intergenic
1119046647 14:71323902-71323924 TATTATGTATAACCTTTACGAGG - Intronic
1122361708 14:101171173-101171195 TATTAGGTGTTAACCTTTGGCGG - Intergenic
1129650355 15:77482656-77482678 TATCAGGGACAAACCTGAGGAGG - Intronic
1148008086 17:44451039-44451061 TATTAGAAATAAACCTCTGGAGG + Intronic
1155574545 18:27230403-27230425 TATGAGGTATAAATATTAGAAGG - Intergenic
1156593942 18:38524284-38524306 TATTAGGCATATACCTTAAAGGG + Intergenic
1158950222 18:62487642-62487664 TATTTGATATATACTTTAGGAGG + Intergenic
1158953098 18:62515378-62515400 TATTACTTATCAACCTTAGAGGG - Intergenic
1159651951 18:70988068-70988090 TGTAAGGAATAAACCTTAGAAGG - Intergenic
1163261388 19:16192441-16192463 TCTTAGGTGTGAACCATAGGCGG - Intergenic
1164794754 19:31016570-31016592 AATTATGTATGAACCTTCGGTGG + Intergenic
928029886 2:27769108-27769130 TATTAGGTATAAATAACAGGTGG + Intergenic
933286124 2:80386408-80386430 TATTATGTATAAATCTTAGTTGG - Intronic
933309093 2:80638199-80638221 TATGAGACATAAACCTTGGGTGG + Intronic
938311792 2:130295029-130295051 GTTTAGGTATAAACCTAAGAGGG + Intergenic
942463223 2:176183913-176183935 TATTAGGTAAAAATCTCTGGGGG + Intergenic
942861936 2:180624508-180624530 TATTTGCTATAAACCCAAGGAGG + Intergenic
944562471 2:200954376-200954398 TAATCTGTATAAACTTTAGGAGG + Intronic
947287123 2:228529232-228529254 TATTAAGTAGAAGCTTTAGGTGG + Intergenic
955160037 3:56456096-56456118 TCTTTGCCATAAACCTTAGGAGG - Intronic
958893729 3:99807792-99807814 CAATAGGAATAAACCATAGGAGG + Intergenic
963408114 3:144894521-144894543 TATTGGGTATAATACTTAGAAGG + Intergenic
971141793 4:23932696-23932718 TATTGGAGATAAATCTTAGGAGG + Intergenic
971564851 4:28125010-28125032 TATTCGGAATCAACCTAAGGGGG - Intergenic
972328040 4:38036654-38036676 TAGAAGGTAGAAACCTTATGTGG - Intronic
976712974 4:88093026-88093048 TATCAGGTTTAAGCCTTAAGTGG + Intronic
977126155 4:93171017-93171039 TACTGAGTATAAACCGTAGGTGG - Intronic
977911805 4:102545954-102545976 TATTAAGGATAAACCTCAGCTGG + Intronic
983554545 4:169048050-169048072 AATTTCCTATAAACCTTAGGAGG + Intergenic
993232535 5:85255065-85255087 AATTAAGTATAAACTTCAGGAGG + Intergenic
993602545 5:89946527-89946549 TATTAGGTATAAAAGTTTAGAGG - Intergenic
993744146 5:91575279-91575301 TCTTAGATATAAACATTAGAGGG + Intergenic
998708093 5:144788037-144788059 TATAATGTATAAACATTTGGAGG + Intergenic
1001821676 5:174715291-174715313 TATTACTTATCAACCTTAGCTGG + Intergenic
1009909694 6:69910890-69910912 AATTAGTTATTATCCTTAGGTGG + Intronic
1011181191 6:84622744-84622766 TATTAGCTATAAATCTTAAATGG + Intergenic
1014361521 6:120482023-120482045 TATTACGTAAAAACATTAAGTGG - Intergenic
1016093645 6:140009602-140009624 TATTAGGTATAAAATTTAAAGGG + Intergenic
1017902136 6:158727544-158727566 TATAAGGTAAAAACCTCAGAAGG - Intronic
1020720744 7:11741673-11741695 TATAAGGTTAAAACTTTAGGAGG + Intronic
1022551886 7:31248479-31248501 TAGTAGTTGTAAACCTTGGGTGG + Intergenic
1023318305 7:38964953-38964975 AATGAGGTATAAAACTAAGGTGG - Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1030930460 7:115517279-115517301 CATTATGTATCAACCTTAGCAGG + Intergenic
1030968826 7:116027801-116027823 TCTTAGGAATGAACATTAGGAGG + Intronic
1031523963 7:122801296-122801318 TATCTGGTATAAACATTAGTAGG - Intronic
1034941132 7:155231129-155231151 AATTATGTATGAATCTTAGGTGG + Intergenic
1038947957 8:32382626-32382648 TCTTGTGTATAAAACTTAGGTGG - Intronic
1043579745 8:81698498-81698520 CATTAGGCATCTACCTTAGGAGG + Intergenic
1045084052 8:98661481-98661503 TATTAGGAATACCCATTAGGAGG - Intronic
1048247100 8:132817601-132817623 TATTAGGTATAAACATTTTGAGG + Intronic
1052149260 9:25093326-25093348 TATTAAGTTTTATCCTTAGGGGG + Intergenic
1052846996 9:33345534-33345556 TATAAGGTATAATTCTTTGGAGG - Intronic
1060859927 9:126946004-126946026 TATTAAGAATAAACCATAGAGGG + Intronic
1186974842 X:14890921-14890943 TTTTTTGTATGAACCTTAGGAGG + Intronic
1192426945 X:71085536-71085558 TATTAGGTATAGTTCTTAAGAGG + Intergenic
1194586539 X:95741669-95741691 TATTGGGTTTAAAACTTTGGAGG - Intergenic
1194845195 X:98798349-98798371 TATTAAGTTTAAACCTTAATTGG + Intergenic
1196538015 X:116870558-116870580 TAAGAGGTAGAAACCTTAGAAGG + Intergenic
1197036836 X:121883542-121883564 TATTTGATATATACTTTAGGAGG - Intergenic
1200509924 Y:4065052-4065074 TATTAGGTATCAACCTGACTTGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic