ID: 909407281

View in Genome Browser
Species Human (GRCh38)
Location 1:75305619-75305641
Sequence GAGAGCTCTGAGTGTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909407281_909407282 9 Left 909407281 1:75305619-75305641 CCTTGGGCACACTCAGAGCTCTC No data
Right 909407282 1:75305651-75305673 CACCTCTAGACTCCCCCTCCTGG No data
909407281_909407283 10 Left 909407281 1:75305619-75305641 CCTTGGGCACACTCAGAGCTCTC No data
Right 909407283 1:75305652-75305674 ACCTCTAGACTCCCCCTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909407281 Original CRISPR GAGAGCTCTGAGTGTGCCCA AGG (reversed) Intronic
No off target data available for this crispr