ID: 909408463

View in Genome Browser
Species Human (GRCh38)
Location 1:75320035-75320057
Sequence AATTATCTCTTCTTTAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909408463_909408465 26 Left 909408463 1:75320035-75320057 CCTAGCCTAAAGAAGAGATAATT No data
Right 909408465 1:75320084-75320106 TATACATAATTCAAATATTCTGG No data
909408463_909408466 27 Left 909408463 1:75320035-75320057 CCTAGCCTAAAGAAGAGATAATT No data
Right 909408466 1:75320085-75320107 ATACATAATTCAAATATTCTGGG 0: 1
1: 1
2: 2
3: 52
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909408463 Original CRISPR AATTATCTCTTCTTTAGGCT AGG (reversed) Intronic