ID: 909408463 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:75320035-75320057 |
Sequence | AATTATCTCTTCTTTAGGCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
909408463_909408465 | 26 | Left | 909408463 | 1:75320035-75320057 | CCTAGCCTAAAGAAGAGATAATT | No data | ||
Right | 909408465 | 1:75320084-75320106 | TATACATAATTCAAATATTCTGG | No data | ||||
909408463_909408466 | 27 | Left | 909408463 | 1:75320035-75320057 | CCTAGCCTAAAGAAGAGATAATT | No data | ||
Right | 909408466 | 1:75320085-75320107 | ATACATAATTCAAATATTCTGGG | 0: 1 1: 1 2: 2 3: 52 4: 516 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
909408463 | Original CRISPR | AATTATCTCTTCTTTAGGCT AGG (reversed) | Intronic | ||