ID: 909426226

View in Genome Browser
Species Human (GRCh38)
Location 1:75528069-75528091
Sequence TAGTGTTCCCAGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909426226 Original CRISPR TAGTGTTCCCAGAGGGAAGG AGG (reversed) Intronic
901619814 1:10574851-10574873 TAGTGATCCCAGAGCTTAGGGGG + Intronic
901685560 1:10941716-10941738 TAGTGGTCACTGGGGGAAGGGGG - Intergenic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902326166 1:15702167-15702189 TAGAATTCCCAGACGCAAGGTGG + Intronic
902727016 1:18343964-18343986 GAGGGTTCCCAGAGGAAAAGAGG + Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
906491547 1:46272609-46272631 AGGTGTTCTCAGAGGGCAGGAGG + Intronic
907182890 1:52586379-52586401 AAGTGTCCCAAGAGGGAGGGGGG + Intergenic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
911032168 1:93500684-93500706 TAGTGGTCCCAGAAGGAAGGGGG + Intronic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
914887623 1:151598392-151598414 GGCTGTTGCCAGAGGGAAGGAGG - Intergenic
915448832 1:155990565-155990587 CAGTCTTCCCTGAGAGAAGGAGG + Intronic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916681547 1:167109457-167109479 TTATGTTCCCAGAGGGATTGTGG - Intronic
921349266 1:214218980-214219002 TAGTGGTCAAAGAAGGAAGGAGG - Intergenic
921766999 1:218983704-218983726 GAGGGGTCCCAGATGGAAGGGGG + Intergenic
922946794 1:229523255-229523277 TAGCGTTCCTGGAGGAAAGGAGG - Intronic
922998134 1:229983145-229983167 GAGGATTCCCAAAGGGAAGGAGG + Intergenic
924797030 1:247300116-247300138 TAGCGTTCAGACAGGGAAGGAGG + Exonic
1064381408 10:14845020-14845042 TAGTGTTCCCAAAGTTAAAGAGG - Intronic
1064620618 10:17213034-17213056 TAGAGCTCACAGAGGGAAAGAGG - Intergenic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG + Intronic
1065561465 10:26968229-26968251 TAGTCTTTCCAGAGGTGAGGAGG - Intergenic
1067515584 10:46938783-46938805 CTGTGATCCCAGAGAGAAGGGGG - Intronic
1067646667 10:48113032-48113054 CTGTGATCCCAGAGAGAAGGGGG + Intergenic
1067731695 10:48817384-48817406 TTGGGCTCCCAGGGGGAAGGCGG - Exonic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1070168134 10:73913214-73913236 GAGTCTTCCCTGAGGGGAGGAGG + Intronic
1070590418 10:77796782-77796804 TGGTGTTCACAGAGGGCATGGGG - Intronic
1072169147 10:92843499-92843521 TAGGGTTCCCAGGGGTGAGGAGG + Intronic
1073379032 10:103063727-103063749 AAGAATTCCCAGAGGGAAGTAGG - Intronic
1073902397 10:108238258-108238280 TAATGTTCACAGAGGGTAGTAGG + Intergenic
1074964141 10:118473905-118473927 TATTGTTTGCAGAGGCAAGGTGG - Intergenic
1076446177 10:130515866-130515888 CAGTTTTCCCAGGAGGAAGGTGG - Intergenic
1076947218 10:133659611-133659633 TCTGGTACCCAGAGGGAAGGGGG + Intergenic
1077995481 11:7448943-7448965 TAGTCTTCACAGAATGAAGGAGG + Intronic
1078098326 11:8313742-8313764 GAGGGCACCCAGAGGGAAGGTGG + Intergenic
1079021280 11:16911242-16911264 TAGTTTTCCCACAGGTGAGGAGG - Intronic
1080388656 11:31825165-31825187 TAGTGTCCCCTTGGGGAAGGGGG - Intronic
1080574832 11:33588725-33588747 TAGGGTTTGCTGAGGGAAGGTGG - Intronic
1080963053 11:37182247-37182269 TACTGTTACCAGAGGAAGGGAGG + Intergenic
1081613501 11:44577380-44577402 AAGTCTTCCCTGAGGGAAGAAGG - Intronic
1081786528 11:45751521-45751543 TGGTGCCCCCAGAGGGAAGCTGG + Intergenic
1082806845 11:57457239-57457261 GGGTATGCCCAGAGGGAAGGGGG + Intergenic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1086927776 11:92659131-92659153 TAACCTTGCCAGAGGGAAGGTGG + Intronic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1091201515 11:133784303-133784325 TAGCATTGCCTGAGGGAAGGGGG + Intergenic
1092069744 12:5623027-5623049 AAGTGTTTCCAGAGGCCAGGTGG + Intronic
1092077347 12:5684807-5684829 TAGAGATCCCAGAGAGAAGCTGG + Intronic
1092661365 12:10741776-10741798 ATTTGTTCCCAGAGGGAGGGTGG - Intergenic
1092740431 12:11623448-11623470 TTGTGTTGCCAGAGGGAATAGGG - Intergenic
1096847253 12:54414117-54414139 TAGTGTGCCGGGAGGAAAGGAGG - Intronic
1096869111 12:54582404-54582426 TGGTCTTCCCTGGGGGAAGGTGG + Intronic
1102730212 12:115102574-115102596 GACTGTCCCCAGAGGCAAGGTGG + Intergenic
1102922494 12:116802644-116802666 TAGAGTCTCCAGAGGGAATGTGG + Intronic
1103282390 12:119770721-119770743 TAGAGTTTGCAAAGGGAAGGGGG - Intronic
1104593032 12:130099785-130099807 AAGTGTTCCCAGTGGGTAGTGGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1105589382 13:21776850-21776872 CAGTGTTCCCACATGGAAAGGGG - Intergenic
1106330448 13:28734555-28734577 TCGTGTGCACAGAGGGAAAGAGG + Intergenic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107333019 13:39321816-39321838 GAGTGGGCCCAGAGGGAATGAGG - Intergenic
1107628104 13:42311290-42311312 TAGTGTTTCAAGAGTGAAGTAGG + Intronic
1108563206 13:51667389-51667411 TAGTTTTCCCATTGGTAAGGAGG + Intronic
1108638160 13:52356777-52356799 TAGTGTGCCCAGAGGGGACATGG + Intergenic
1110959256 13:81599908-81599930 GAGTCTTCCCAGAGGGAATTTGG - Intergenic
1111222997 13:85229230-85229252 TCTTTTTCCCAAAGGGAAGGGGG + Intergenic
1114576985 14:23724570-23724592 TAGTGATGTCAGAGGTAAGGGGG + Intergenic
1117438415 14:55739557-55739579 AAGTGTTCAAAGAGGGAAGGGGG + Intergenic
1117648932 14:57882180-57882202 TAGTTTCTCCAGGGGGAAGGGGG - Intronic
1117747549 14:58886154-58886176 TAGTTTTCAAAGAGGGAAAGTGG - Intergenic
1118006779 14:61570352-61570374 TGGTTTTCCCAGGGGGAAGTCGG - Intronic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120056642 14:79932055-79932077 TAGTGGGCTCAGAGGGCAGGGGG - Intergenic
1121364524 14:93295999-93296021 TCATGTTCCCCGAGGGTAGGGGG - Exonic
1202923628 14_KI270724v1_random:5416-5438 TCTGGTACCCAGAGGGAAGGGGG - Intergenic
1124052213 15:26207961-26207983 AAGTGAGCCCATAGGGAAGGAGG + Intergenic
1124424835 15:29555180-29555202 AGGTGTTCCCCGAGGAAAGGGGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1127964853 15:63915903-63915925 AATTGTTCCCAGAGGGAATGTGG + Intronic
1129590168 15:76907698-76907720 AAGTATTTCCAGAAGGAAGGAGG - Intergenic
1129594278 15:76948119-76948141 TAGTTTTCCCAGATGTGAGGTGG - Intronic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1130193907 15:81761341-81761363 TATTGTTCCCAGAAGAAAGGAGG - Intergenic
1133728301 16:8557265-8557287 TAGTGCTCCCATGGGCAAGGTGG - Intergenic
1134690112 16:16185462-16185484 CAGCCTTCCCAGAGTGAAGGGGG + Intronic
1136922484 16:34344318-34344340 TAGTGATTCAACAGGGAAGGGGG - Intergenic
1136982089 16:35067488-35067510 TAGTGATTCAACAGGGAAGGGGG + Intergenic
1138558482 16:57786553-57786575 TGGTGCTCCCTGAGGGGAGGAGG - Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138665063 16:58559750-58559772 TGTTGCTCCCAGAGAGAAGGGGG + Intronic
1140418597 16:74797020-74797042 TTGAATTCCCAGAGGGAGGGAGG + Intergenic
1140471615 16:75218687-75218709 TTCTGTTCCCAGAGGGGAAGTGG - Intergenic
1141405983 16:83793551-83793573 TTGTGTTCCCAGAGGAAAAAAGG - Intronic
1141831972 16:86514754-86514776 TGGTGTTCCCTAGGGGAAGGAGG - Exonic
1143004404 17:3819118-3819140 TAGTGTTCCTAGATGCAAGGGGG + Intronic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1144074221 17:11702375-11702397 TACTGTTAACTGAGGGAAGGAGG - Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144391877 17:14801062-14801084 CAGTGTTCCAAGAGAGAATGTGG - Intergenic
1145902951 17:28499820-28499842 TCTTGCTCCCAGAGGGAAGCTGG + Intronic
1146916242 17:36680188-36680210 TATTTTCCCCAGAGGGAAGCGGG + Intergenic
1147158506 17:38557687-38557709 TAGTGTTTTCAGAAGGAAGGAGG - Intronic
1147628307 17:41914173-41914195 TAGTTTGCCTAGAGGGAATGGGG - Intronic
1147840977 17:43371238-43371260 GAGAGTTACCAGAGGTAAGGAGG + Intergenic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1149356039 17:55840308-55840330 TAGATTCCCCAGAGGGAAGATGG + Intronic
1149627888 17:58092684-58092706 TGCTGTTCCCAGTGGGGAGGGGG - Exonic
1150223151 17:63508405-63508427 GAGCTTTCCCAGAGTGAAGGTGG + Intronic
1150428072 17:65093208-65093230 TGGGCTTCCTAGAGGGAAGGGGG + Intergenic
1151356055 17:73559242-73559264 TAGTTTTCCCAGAGGCAGGCAGG - Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152025133 17:77804041-77804063 TAGTGAGCCCAGTGGGAAGCAGG + Intergenic
1152322371 17:79614911-79614933 TAGGGCCCCCAGAGAGAAGGAGG + Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153087524 18:1305040-1305062 TTGTTTTCCCAGAGAAAAGGAGG + Intergenic
1153160665 18:2201146-2201168 TAGAATTCCCAGAGGGAATGTGG + Intergenic
1153577109 18:6533330-6533352 TAGTGTTGACATATGGAAGGGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1158849641 18:61482525-61482547 TAGTGTTTCTGGAGAGAAGGTGG - Intronic
1160817935 19:1044814-1044836 TGGTGTTCCCAGGGGGAGGCGGG + Intronic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1162781871 19:13010866-13010888 GGGTGTTCCGAGAGGGATGGGGG - Intronic
1162964440 19:14149288-14149310 TCGTCTTCCCTGCGGGAAGGTGG + Exonic
1163951012 19:20586321-20586343 TAGTGTTCCCAGAGAAATGAAGG + Intronic
1164492889 19:28730451-28730473 TAGTGTTCCCAAGGATAAGGGGG + Intergenic
1166644683 19:44522856-44522878 TGGTGTTGCCAGTGGGGAGGTGG - Exonic
1167706116 19:51082218-51082240 TTTTGTTGTCAGAGGGAAGGTGG - Intronic
1167748277 19:51365606-51365628 TGTTGTCCCCAGAGGGAAGCTGG - Intronic
1168094441 19:54106715-54106737 TTATGTTCAGAGAGGGAAGGGGG - Intronic
925027816 2:623475-623497 TTGTGTTCCCAGAGGCATGCTGG + Intergenic
927172123 2:20379181-20379203 TAGTGGGCCCAGAGGGACAGAGG - Intergenic
927650441 2:24909944-24909966 TGGTGGTCTCAGAGAGAAGGTGG - Intronic
929595723 2:43174433-43174455 AAGGGTTGCCAGAGGGAAAGAGG + Intergenic
929801549 2:45108758-45108780 GAGTGTTTCAAGAAGGAAGGAGG + Intergenic
930552464 2:52852673-52852695 CAGAGTTCCCGGAGGGGAGGGGG - Intergenic
931800436 2:65752886-65752908 TAGTTTTCAGAGAGGGAATGGGG + Intergenic
932174351 2:69585969-69585991 GGGTGGTGCCAGAGGGAAGGTGG - Intronic
932570156 2:72934307-72934329 TATTATTCCCATAGGGAAGGGGG - Exonic
933171128 2:79127263-79127285 AAGTGTTACTAGAGGAAAGGAGG - Intergenic
933573880 2:84044960-84044982 TAGTTTTCCTTGAGGGCAGGCGG - Intergenic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
934557661 2:95296031-95296053 GACTGTTTCCAGAGGGGAGGTGG - Intergenic
935802018 2:106707294-106707316 TAATTTTCCAAGAGTGAAGGAGG + Intergenic
939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG + Intronic
939513396 2:143135673-143135695 GAGAGTTTCAAGAGGGAAGGAGG - Intronic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
941305604 2:163861812-163861834 TTGATTTCCCAGAGGGCAGGTGG - Intergenic
944327332 2:198421900-198421922 TAGTGTTCTCAGGGAAAAGGTGG + Intronic
945681955 2:212924966-212924988 TAGAGTTCCCAGAGGGAGCATGG - Intergenic
945714631 2:213343005-213343027 TGGTGTACACAGAAGGAAGGAGG + Intronic
946227709 2:218273032-218273054 CAGTGTTCCCAGCTGGATGGTGG + Intronic
946961527 2:224990656-224990678 TAGTCTTCCCTGAGTGATGGGGG + Intronic
948914002 2:241021057-241021079 AGGTGTTCCCATAGGGAAGAAGG - Intronic
1169681178 20:8215538-8215560 TCGTGCTCCAAGAGGGACGGGGG - Intronic
1170590361 20:17766872-17766894 GAGAGTTCCCAGTGGGAAGCTGG + Intergenic
1172843378 20:37915327-37915349 TAGTGTTCCCAGAGCCTGGGAGG - Intronic
1173759542 20:45547450-45547472 TAGTGTTCCCAGCAAGAAAGGGG - Intronic
1174048345 20:47749662-47749684 TTGTGTTCACAGATGGAAAGTGG + Intronic
1178517804 21:33263587-33263609 AAGTGTTCTCCAAGGGAAGGAGG + Exonic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1184497360 22:44849700-44849722 TAGTGCTCCAAGAAGAAAGGAGG - Intronic
1184642918 22:45881669-45881691 TGGTGTTCCTTGAGGGGAGGAGG + Intergenic
1185161656 22:49233629-49233651 TAGGCTTCCCAGTGGGGAGGAGG + Intergenic
949424250 3:3899372-3899394 GAGTGATCCAAGAGAGAAGGAGG - Intronic
950858678 3:16128478-16128500 TAGTGGTCCCAGAGTGAATCTGG + Intergenic
950877963 3:16294971-16294993 TTGTGAACCCAGAGGGCAGGAGG - Exonic
953570385 3:44066910-44066932 TGGTTTTCTCAGAGGGAAGGAGG - Intergenic
954375076 3:50189805-50189827 TAGTGTTCCCTGGGGTATGGAGG - Intergenic
956714455 3:72066152-72066174 TAGTATTCCAAGAGGCAAGGTGG + Intergenic
957080238 3:75630805-75630827 TCTGGTACCCAGAGGGAAGGGGG - Intergenic
957556787 3:81772341-81772363 TAGAGTTTCCAGAGGAAATGTGG + Intergenic
957569794 3:81931842-81931864 TACTGTTCCAACTGGGAAGGAGG - Intergenic
959283448 3:104377732-104377754 TAGATTCCCCAGAAGGAAGGTGG + Intergenic
962288380 3:134107412-134107434 CAGTGTTGCCAGAGAAAAGGAGG - Intronic
963795997 3:149631555-149631577 TAGTTATGCCAGAGGGTAGGTGG - Intronic
964932962 3:162048171-162048193 TAGTGTTGGGAGAGGGAAGCTGG + Intergenic
964967291 3:162511767-162511789 AAACGTTCCCAGAGGGAGGGTGG - Intergenic
965501394 3:169460125-169460147 TAGTGTTCCCAGTGAGGACGTGG - Intronic
969533699 4:7742899-7742921 TCGTGGTCCCAGAGGTGAGGTGG + Intergenic
971968234 4:33590980-33591002 TAGAGTTTCCAGAGAGAATGAGG + Intergenic
973773684 4:54227581-54227603 TAGTTGCCCCAGAGGGTAGGAGG - Intronic
979984172 4:127294664-127294686 TTGTGTTCCCAGGGGGATGTTGG - Intergenic
980639644 4:135560572-135560594 GTGTGTACCCAGAGAGAAGGAGG - Intergenic
982360264 4:154511953-154511975 CATTGTTCCCAGGAGGAAGGTGG + Intergenic
982856420 4:160387066-160387088 TTGTGTTCCCAAAGAGAAAGTGG - Intergenic
985450676 4:190060411-190060433 TCTGGTACCCAGAGGGAAGGGGG + Intergenic
986960739 5:13208568-13208590 TGGTGTTACTAGAGGGTAGGAGG + Intergenic
988551409 5:32204101-32204123 TACAGATCCCAGAGGGAAGCGGG - Intergenic
991191444 5:63878924-63878946 TTGTGTTCCCTGAGGATAGGGGG - Intergenic
991202683 5:64012655-64012677 TCGAGTTCCCAAAGGGAAGGTGG + Intergenic
991509117 5:67357425-67357447 AAATGCTCACAGAGGGAAGGAGG - Intergenic
992657303 5:78923078-78923100 AAGTGATCCCAGAGAGCAGGAGG + Intronic
996220420 5:120925131-120925153 GATTCTTCACAGAGGGAAGGGGG + Intergenic
997775112 5:136597176-136597198 AAGTGTACCCAGAGAGTAGGGGG - Intergenic
998228983 5:140347198-140347220 TAATGTCCCCTGAGGGAAGATGG - Intergenic
998497647 5:142604663-142604685 AAGTGTTCCCTGGAGGAAGGTGG + Intronic
1002494019 5:179599654-179599676 CTGTTTTCCCAGAGGGGAGGAGG + Intronic
1003974371 6:11328825-11328847 TAGTGGCCCCAGAGGGGAGCAGG + Intronic
1004288548 6:14345738-14345760 TAGAGTTTCCAGAAGGAAGGAGG + Intergenic
1005501336 6:26431428-26431450 TTGTGTGACCAGAGGGGAGGAGG - Intergenic
1005505904 6:26468635-26468657 TTGTGTGACCAGAGGGGAGGAGG - Exonic
1005700286 6:28393870-28393892 TAATCTTCCCAGAGAGAAGTGGG - Intronic
1006583727 6:35091896-35091918 AAGTGTTCCCAGAGGGCTGGTGG + Intergenic
1006739513 6:36297416-36297438 TTCTGTTCCCAGATGGCAGGTGG - Intronic
1006803919 6:36776566-36776588 GGGTGGTCCCAGAGGGATGGGGG + Intronic
1008693838 6:54010856-54010878 AAGTGGTCCCAGTGGGAATGAGG + Intronic
1009965391 6:70572956-70572978 AAGTGTTCCCAGAAGTAAAGTGG - Intronic
1010456290 6:76059542-76059564 TAGTGTTAGCAGAGGAAAGTTGG + Intronic
1013958447 6:115868335-115868357 TATTGTTACAAGAGGGACGGAGG + Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018226943 6:161637847-161637869 GCGTGCTCCCAGAGGGGAGGTGG + Intronic
1019913635 7:4116678-4116700 TACTCTTCTCAGAGGGCAGGAGG + Intronic
1021172510 7:17415018-17415040 AAGTTTTCCTATAGGGAAGGAGG - Intergenic
1021611463 7:22461696-22461718 TTGTGTTCCCAGAGAGACAGTGG - Intronic
1024138780 7:46440138-46440160 CAGTGGTCCCAGAGAGAAAGTGG + Intergenic
1024358099 7:48438407-48438429 TAGTGTTTCCATAGGGACAGGGG + Intronic
1026765540 7:73157230-73157252 TTGTGTTCCCAGAGGCCAGCAGG - Intergenic
1026857183 7:73762563-73762585 AAGGGCTCCAAGAGGGAAGGGGG - Intergenic
1027042013 7:74966923-74966945 TTGTGTTCCCAGAGGCCAGCAGG - Intronic
1027081628 7:75235431-75235453 TTGTGTTCCCAGAGGCCAGCAGG + Intergenic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1027504286 7:78996119-78996141 TATTGTTCCCAGAGGGAGAATGG - Intronic
1027954204 7:84858931-84858953 TAATGTTTGGAGAGGGAAGGGGG - Intergenic
1028336163 7:89658725-89658747 AAGTTTTCCCAGAGGGTAGTTGG + Intergenic
1028484120 7:91339763-91339785 TAGTCTTCCCAAAGGAAAGAAGG - Intergenic
1029390213 7:100270012-100270034 TTGTGTTCCCAGAGGCCAGCAGG + Intronic
1029580418 7:101433474-101433496 AGGTGTTTCCAGAGGGAGGGTGG + Intronic
1029819687 7:103134227-103134249 TGTTGTTCACAGAGGGAAAGAGG - Intronic
1031268908 7:119619816-119619838 TAGTTTTCACAGAGGGAAAAGGG - Intergenic
1033360977 7:140638923-140638945 TGGTGTTCCTGGAAGGAAGGGGG + Intronic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1037055693 8:14438570-14438592 AAGTGTTCCTAGAGGGAATTAGG + Intronic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1043661374 8:82746446-82746468 TGTTCTTCCCAGAGAGAAGGAGG + Intergenic
1043727454 8:83629110-83629132 TAGAGCTCCCAGAGGGAGGGAGG - Intergenic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1046776566 8:118170013-118170035 TAGTGTTCCCATAGGGTCTGAGG - Intergenic
1047181237 8:122590102-122590124 TATTGCTACCAGAGGTAAGGTGG - Intergenic
1048073712 8:131045531-131045553 TCCTGTTTCCAAAGGGAAGGAGG + Intergenic
1048493666 8:134917625-134917647 TAGTGAATCCAGAGGGAAGGAGG - Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049685664 8:143938320-143938342 TGCTGGTCCCAGAGGGAAGGAGG + Intronic
1051480953 9:17560050-17560072 AAATGTTCACAGATGGAAGGTGG + Intergenic
1051693502 9:19742957-19742979 TAGAGATCCCAGAGGGAAATGGG + Intronic
1053167812 9:35856872-35856894 TGGGATTCCCGGAGGGAAGGGGG + Intergenic
1054171938 9:61848486-61848508 TAGAGTCCCCAGAAGGAAAGCGG - Intergenic
1054446799 9:65377498-65377520 TAGAGTCCCCAGAAGGAAAGCGG - Intergenic
1054665597 9:67732326-67732348 TAGAGTCCCCAGAAGGAAAGCGG + Intergenic
1055120323 9:72652535-72652557 GACAGTTACCAGAGGGAAGGTGG + Intronic
1057267116 9:93625136-93625158 TAGTGGTGCCAGAGGGTGGGAGG - Intronic
1057462010 9:95271522-95271544 AGGTGTCCCCAGAGGGAATGTGG + Intronic
1058506581 9:105672559-105672581 TAGTGTTACCAGAGAAAAGCAGG - Intergenic
1059494839 9:114700856-114700878 TAATGTTGCTAGTGGGAAGGAGG - Intergenic
1059788409 9:117612585-117612607 TAGTAATCTCATAGGGAAGGAGG - Intergenic
1061110885 9:128570130-128570152 TTGTTTTCCCAGAGTGAATGAGG + Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061754829 9:132804960-132804982 GGATGTTCCCAGAGGGAAAGAGG + Intronic
1061844033 9:133376566-133376588 GAGTGTTCCCTGCGGGGAGGCGG + Intronic
1185798032 X:2983699-2983721 TAGAGTCTCCAGAGGGAATGTGG - Intergenic
1186417289 X:9394743-9394765 GTGTGTTTCCAGAGAGAAGGGGG + Intergenic
1187736619 X:22311404-22311426 TAGTGTGCCCACAGTGAGGGGGG + Intergenic
1188368256 X:29336725-29336747 TAGTGTTACCAGATTGAGGGGGG + Intronic
1188751952 X:33914925-33914947 TATTGTTCCCAGACAGAATGGGG - Intergenic
1194856817 X:98940646-98940668 TACAGATCCCAGAGGGAAGAAGG - Intergenic
1197080801 X:122413004-122413026 TAGTGTTTAGAGGGGGAAGGAGG + Intergenic
1197354690 X:125423515-125423537 TAGTGTTTGCAGAGGGCTGGGGG + Intergenic
1197677468 X:129346089-129346111 TAGTATTGCAAAAGGGAAGGTGG + Intergenic
1199316349 X:146382737-146382759 TAGAAGTCCCAGAGGGAGGGAGG + Intergenic
1199542577 X:148973361-148973383 AAATGTTCCCTGTGGGAAGGGGG + Intronic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic