ID: 909427367

View in Genome Browser
Species Human (GRCh38)
Location 1:75541803-75541825
Sequence GGTTAGGGGTGCATTTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909427367 Original CRISPR GGTTAGGGGTGCATTTTACA GGG (reversed) Intronic
902181786 1:14694901-14694923 TGTTAGGGGAACATATTACAGGG + Intronic
903577995 1:24351069-24351091 GGCTAGGAGTGCATTTCCCAGGG - Intronic
904306577 1:29593971-29593993 TCTTAGGGGTGCATCTTGCAGGG + Intergenic
905421954 1:37853164-37853186 GGTTAGAGTAGCATTTTAGAAGG - Intronic
907973314 1:59406397-59406419 TGCTTGGGGTGCATTTTAAATGG - Intronic
909427367 1:75541803-75541825 GGTTAGGGGTGCATTTTACAGGG - Intronic
913340862 1:117756999-117757021 GGTTTGGGGTGGATTTTAGGAGG + Intergenic
915670526 1:157485494-157485516 GGTTATGGGTCCATCATACATGG + Intergenic
916283900 1:163083084-163083106 GTTTGGGGAGGCATTTTACAGGG + Intergenic
917692496 1:177483762-177483784 GGTTAGGGCTGCATTTAAATGGG - Intergenic
922143877 1:222918502-222918524 GGAGAAGGGTGCAATTTACAGGG - Intronic
922509539 1:226152405-226152427 GGTTTGGGGTGTATTTTGAATGG - Exonic
922539323 1:226407471-226407493 GGTTGGGGGGGAATTGTACATGG - Intronic
922567824 1:226612385-226612407 GGTTCAGGGTGCATTTGAAAGGG + Intergenic
1065057096 10:21857182-21857204 GGTTTGGGGGCCATTTTACTTGG + Intronic
1065141911 10:22726153-22726175 GGTCAGTGGTGCCTTTTAGAAGG - Intergenic
1069037221 10:63657985-63658007 GGTTAGGGGAGCCTTTTCCCTGG - Intergenic
1073581924 10:104676339-104676361 GGTTATGGATGCTTTTTACTAGG + Intronic
1079002210 11:16767450-16767472 ATTTTGAGGTGCATTTTACATGG + Intergenic
1082613887 11:55335317-55335339 GGTTGCGGGTTCATTTCACAGGG - Intergenic
1082748367 11:56993091-56993113 GGTTAAAGGTGCATATCACATGG + Intergenic
1083193441 11:61068791-61068813 CGTCATGGGTGCCTTTTACATGG - Intergenic
1084006308 11:66325268-66325290 GGTTGGGGGTGTATTTACCATGG + Intergenic
1086559319 11:88148795-88148817 TGTTAGGATTGCATTTCACATGG - Intronic
1096912078 12:54994582-54994604 GTTCAGGGGTACATGTTACATGG + Intergenic
1100067843 12:90671893-90671915 GGCTAGAGTTTCATTTTACATGG + Intergenic
1101801641 12:108027613-108027635 GGTTAGGGGTGCAGTTTGCCTGG + Intergenic
1102945804 12:116987029-116987051 GGCCAGGGGTGCCTTTTCCAAGG - Intronic
1106065753 13:26347106-26347128 GGTTAGGGGTGCTTTTTTACTGG + Intronic
1108056167 13:46487559-46487581 TCTTAGGGGTTCTTTTTACAAGG + Intergenic
1110866257 13:80399234-80399256 GGAGAAGGGTGCAATTTACAGGG - Intergenic
1111097556 13:83535096-83535118 GATTAAGCGTGTATTTTACAAGG - Intergenic
1111327823 13:86722283-86722305 GATAAGGGGTTCCTTTTACAGGG + Intergenic
1111905332 13:94249166-94249188 GGTTAAGGGAACATTTTATAGGG - Intronic
1115095121 14:29625857-29625879 AGTTATGAGTTCATTTTACAGGG + Intronic
1116446838 14:45021066-45021088 GGTTAGGGGTGCTATGTACCCGG + Intronic
1116508495 14:45714881-45714903 GGAGAAGGGTGCAATTTACAGGG + Intergenic
1118741252 14:68741003-68741025 GGGTAGGGGTGCCTGTTCCAAGG + Intergenic
1120080006 14:80205477-80205499 GGTTAGAGGCGCATTTGTCAAGG - Intronic
1121218466 14:92266561-92266583 TGTTAGGGGTTTATTTTTCAGGG + Intergenic
1123964731 15:25443588-25443610 GGTGAGGGCTGCAGTTTCCAAGG - Intergenic
1124321769 15:28718347-28718369 GGTCAGGGGCACATTCTACAAGG + Intronic
1124522867 15:30420185-30420207 GGTCAGGGGCACATTCTACAAGG + Intergenic
1124535798 15:30546032-30546054 GGTCAGGGGCACATTCTACAAGG - Intergenic
1124762852 15:32461568-32461590 GGTCAGGGGCACATTCTACAAGG + Intergenic
1124775774 15:32587490-32587512 GGTCAGGGGCACATTCTACAAGG - Intergenic
1124973460 15:34513345-34513367 GGTCAGGGGCACATTCTACAAGG + Intergenic
1125124618 15:36205674-36205696 GATCAGTGGTGCATTTAACAAGG + Intergenic
1129483650 15:75846919-75846941 GGTCAGGGGCACATTCTACAGGG - Intronic
1130365582 15:83235255-83235277 GGTTTGGGGTATATTCTACAGGG + Intergenic
1132282968 15:100635912-100635934 GGTTCTGGGTGCATTTCACAAGG + Intronic
1135685349 16:24494350-24494372 GGTGAGGGGGGCATGGTACATGG - Intergenic
1137671111 16:50279802-50279824 CCTTGGGGGTGCATTTTAAAGGG + Intronic
1144372531 17:14605797-14605819 GATTTGGGGTGCATTTTGGAAGG - Intergenic
1144452945 17:15396320-15396342 GGAGAGGGTTGCATTTCACAAGG + Intergenic
1145813340 17:27778163-27778185 GGTGAGGGCGTCATTTTACATGG + Intronic
1148486278 17:47992977-47992999 GTTTAGAGGTGCTATTTACATGG - Intergenic
1149115440 17:53089103-53089125 GGTTGGGGGTAGTTTTTACAAGG - Intergenic
1150449920 17:65258224-65258246 GGTAAGGAATACATTTTACAGGG + Intergenic
1150941308 17:69697402-69697424 GGTGAAAGGTGCTTTTTACATGG + Intergenic
1156472039 18:37383424-37383446 AGCTTGGGGTGCATTTTAGAAGG + Intronic
1157417250 18:47514014-47514036 TATTAGGTGTGCATTTAACAGGG - Intergenic
1158327760 18:56328908-56328930 GGAATGGGATGCATTTTACAGGG - Intergenic
1159309448 18:66688048-66688070 GGTTAAGGATGCATTTGAAAAGG - Intergenic
1162774381 19:12970116-12970138 GGCTTGGGTCGCATTTTACAAGG - Intronic
1164887937 19:31799166-31799188 TGTTAGGCATGGATTTTACAAGG - Intergenic
925781535 2:7386596-7386618 CTTTAGGTGTGCATTTTACTGGG + Intergenic
928078804 2:28289907-28289929 GGATGGGGGTGCATTTTGGAGGG - Intronic
929727445 2:44445420-44445442 GGTTCGGGATGCATTTGAAAGGG - Intronic
936044597 2:109176892-109176914 GGATAGGGATGCATTTGTCAGGG + Intronic
938199760 2:129363032-129363054 AGTTAGGGCTGCAGTTTGCATGG - Intergenic
942862139 2:180627606-180627628 GTTTAGGGGTGCTTTTTTGATGG - Intergenic
943145221 2:184035316-184035338 GGTGAAAGGTGCATCTTACATGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
1170561820 20:17565031-17565053 TGTTAGGGGTTCAAGTTACATGG - Intronic
1171264402 20:23759193-23759215 GGTTAGGGTGGCGTTTGACAGGG + Intergenic
1174732802 20:52934600-52934622 GGTGAGGGGTGCTTTTAAGACGG + Intergenic
1177755491 21:25342264-25342286 GGCTAGAGGTACATCTTACATGG - Intergenic
1182201068 22:28570661-28570683 GATTGGGGGTACATGTTACATGG - Intronic
1185049921 22:48548631-48548653 GTTCAGGGCTGCATTTCACAGGG + Intronic
956700943 3:71957956-71957978 GGTGAAAGGTGCATCTTACACGG + Intergenic
957335976 3:78829958-78829980 ACTTATGGGTGAATTTTACAGGG + Intronic
966021288 3:175214799-175214821 GGTTAGGGCTGTAATTAACAAGG - Intronic
966061307 3:175759897-175759919 GGTTTGGGCTTCATTTTTCATGG + Intronic
967977095 3:195041456-195041478 GGTTTGGGGAGGATGTTACATGG - Intergenic
970352523 4:15217311-15217333 GGTTGGGGGAGCATGTCACAGGG + Intergenic
972977774 4:44658734-44658756 GGTGAGAGGCACATTTTACATGG + Intronic
974941061 4:68468454-68468476 GGTTTGGGAAGCATTTGACATGG + Intronic
974948201 4:68553913-68553935 GCTTAGGGGTGCCTTTTGCCTGG - Intronic
974957269 4:68657191-68657213 GCTTAGGGGTGCCTTTTGCCTGG - Intronic
977354870 4:95932996-95933018 GGTTAGGGGAGCATTGTGAAAGG + Intergenic
980227876 4:130012409-130012431 AGTTCGGGATGCATTTTACAAGG - Intergenic
980803115 4:137778727-137778749 GGTTAGTGATGCATATTTCAAGG + Intergenic
981799166 4:148636023-148636045 GCTTAGGGGTGGAGGTTACAAGG + Intergenic
982625870 4:157765699-157765721 GTTTTGGGGTGCATTTTTCTGGG + Intergenic
983321615 4:166202553-166202575 GGTTAAGGATGCATTTGAAAGGG - Intergenic
985401911 4:189601331-189601353 GGCAAGGGGTGCATGCTACAAGG + Intergenic
986138006 5:5000659-5000681 GGTGAAAGGTGCATTTCACATGG + Intergenic
990115815 5:52389030-52389052 GGTTAGATGAGCATTTTAGAAGG - Intergenic
990768898 5:59220533-59220555 GGTTAGTTGTGGATTTTAAAAGG + Intronic
992162956 5:74020368-74020390 GTTCAGGGGTGCACTTTCCATGG + Intergenic
996332120 5:122341763-122341785 TACTAGGGGTGGATTTTACATGG - Intronic
1007681318 6:43635679-43635701 GGTTAGGCGTACATTTGCCAGGG + Intronic
1012691523 6:102319079-102319101 GGTGAAAGGTGCTTTTTACATGG - Intergenic
1019993513 7:4708505-4708527 GGTTAGGGTGGAATTTTACATGG + Intronic
1021504197 7:21363287-21363309 GGGTAGGGGTATATATTACATGG - Intergenic
1021561569 7:21972724-21972746 GGTTAGGGCTGCATACTCCATGG - Intergenic
1028741840 7:94284447-94284469 GGTTGTGGGTAAATTTTACAAGG + Intergenic
1036936525 8:13007577-13007599 GGGAAGGGGTGCATGTCACATGG + Intronic
1037582827 8:20255750-20255772 TGTTAGGGTAGCATTTTAAAAGG + Intronic
1037866763 8:22450395-22450417 GGTGAGTGGTGCAATTAACAGGG - Intronic
1042829178 8:73008563-73008585 AGTCAAGGTTGCATTTTACAAGG + Intergenic
1043785320 8:84391072-84391094 AGTGAGTGGTGCATTTTGCAAGG - Intronic
1048256859 8:132911456-132911478 GTTTAGGAGTGAATGTTACATGG + Exonic
1049982693 9:919421-919443 GGGGAGGGGGGCATTTTACAGGG + Intronic
1050872633 9:10592761-10592783 GCTTATTGGTGCATTTTACAGGG - Intronic
1051955436 9:22687493-22687515 GTTTAGGGGTGCAGGGTACAAGG - Intergenic
1055748294 9:79475010-79475032 TGTCAGGTGTGCATTTTATATGG - Intergenic
1055759486 9:79591430-79591452 GGTTTGGGATGCATTATAGAAGG + Intronic
1058269152 9:102948067-102948089 GCTTAGGGGTTCTTATTACATGG + Intergenic
1059874295 9:118617059-118617081 GTTTTTGTGTGCATTTTACAGGG - Intergenic
1186678720 X:11848697-11848719 GGTTAGGAGGGGATTTAACAGGG - Intergenic
1188872802 X:35394653-35394675 GGTTAGGGTGGCATTTGTCATGG + Intergenic
1188881304 X:35495033-35495055 GGTTATGATTGCATTTTAAATGG - Intergenic
1189904948 X:45748638-45748660 GGATAAGGGTGGAATTTACAAGG + Intergenic
1190215728 X:48478367-48478389 GGAGAGGGGTGAATTTTGCAAGG + Intronic
1191694892 X:63979226-63979248 GGTGAAAGGTGTATTTTACATGG - Intergenic
1194204929 X:91001704-91001726 GTTCAGAGGTGCATTTTAAAGGG + Intergenic
1195150748 X:102067265-102067287 AGTTCAGGGTACATTTTACATGG - Intergenic
1198674112 X:139113586-139113608 GGTTGGGGGTGGATTATACTTGG + Intronic
1199531403 X:148851770-148851792 GTTTGGGGGTGCATGTGACACGG + Intronic
1200550756 Y:4576849-4576871 GTTCAGAGGTGCATTTTAAAGGG + Intergenic
1200775865 Y:7169969-7169991 GATGATTGGTGCATTTTACAGGG - Intergenic