ID: 909431609

View in Genome Browser
Species Human (GRCh38)
Location 1:75593842-75593864
Sequence GTCAGGGGATGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1618
Summary {0: 1, 1: 0, 2: 10, 3: 148, 4: 1459}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909431601_909431609 -4 Left 909431601 1:75593823-75593845 CCAAAGGCTGAGAAGGGTAGTCA No data
Right 909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG 0: 1
1: 0
2: 10
3: 148
4: 1459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909431609 Original CRISPR GTCAGGGGATGGAGGGAAGA GGG Intronic
900093587 1:931133-931155 GTCAGGGGTGGGAGGGAGGGAGG - Intronic
900182599 1:1318912-1318934 GGCAGGGGCTGGAGGGGAGATGG - Intronic
900191136 1:1352785-1352807 GACAGGGGAGGGAGTGAAGTTGG - Exonic
900300241 1:1973449-1973471 GGGAGGGGATGGAGGCCAGAAGG + Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
900561462 1:3309152-3309174 GACAAGGGAGGGAGGGCAGAAGG - Intronic
900586466 1:3434772-3434794 GACAGAGGAGGGAAGGAAGATGG - Exonic
900861875 1:5239628-5239650 GTTAGCGGATGGAGAAAAGAGGG + Intergenic
900876654 1:5347720-5347742 GACAGGGGCTGGAGGGATGGCGG + Intergenic
900993386 1:6107989-6108011 GATGGGGGATGGAGGGATGAAGG + Intronic
900993404 1:6108039-6108061 GTGAAGGGATGGAGGGATGGAGG + Intronic
901105025 1:6748568-6748590 GTCAGGGGAGGGAGGTGATAGGG + Intergenic
901258988 1:7857264-7857286 GGGAGAGGAAGGAGGGAAGAGGG - Intergenic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
902101795 1:13996508-13996530 GTCAGGGGAGGGAGGGAGGCTGG + Intergenic
902405026 1:16177832-16177854 GTCAGGGGATGGCAGAAATAGGG - Intergenic
902527188 1:17066874-17066896 GGCAGGGGATGTCGTGAAGATGG - Exonic
902632940 1:17716464-17716486 GTGAAGGGAGGCAGGGAAGAAGG + Intergenic
902803696 1:18847514-18847536 GTCGGGGACTGGGGGGAAGAGGG + Intronic
902974481 1:20079007-20079029 GGCAGAGGCAGGAGGGAAGATGG + Intronic
903350838 1:22715715-22715737 GTCAGGGGCTGGTTGGGAGAAGG + Intronic
903524125 1:23980083-23980105 GGGAGGGGACGGAGTGAAGATGG - Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903735480 1:25527712-25527734 GCCAGAGGCTGGAGGGAGGAGGG + Intergenic
903754959 1:25654135-25654157 GTTGGGGGATGAAGGGATGAAGG - Intronic
903776170 1:25795213-25795235 GTTAGGGGATGGACAGAGGAAGG - Intergenic
903808210 1:26020445-26020467 GTATGGGGATAGAGGGATGAAGG + Intronic
904049308 1:27628933-27628955 GTCAGGGGATGTAGGGCACAGGG + Intronic
904241719 1:29150806-29150828 GTAAGGGGATAGGGGAAAGACGG - Intronic
904653644 1:32025710-32025732 GGGAAGGGAGGGAGGGAAGAAGG - Intronic
905264409 1:36741067-36741089 GCCAGGGGCTAGAGGGAAGAGGG - Intergenic
905281254 1:36850759-36850781 ATCAGGGGCTGGAGGGAATCAGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905920433 1:41715429-41715451 GCCTGGGGAGGGTGGGAAGATGG + Intronic
905936463 1:41827923-41827945 GGCAGGGAAGGGAGGGAAGAGGG + Intronic
906094101 1:43208640-43208662 GTCGTGGGATGGGGGGAACAGGG + Intronic
906197731 1:43939287-43939309 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
906299264 1:44670333-44670355 GTGAGTGGCTGGAGGGAACAGGG - Intronic
906308477 1:44736639-44736661 GTCAAGGGATGGAATGAAGAAGG - Intergenic
906460433 1:46032044-46032066 GTCAGGGGCTGTGGGGAAAATGG + Intronic
906549760 1:46654685-46654707 GTCAGGGGGTGGAGGGCTGGGGG - Intronic
906659460 1:47572255-47572277 CCCAGGGGATGGATGGATGATGG - Intergenic
906843578 1:49165779-49165801 GGAAGGGGATGGAGGAAGGAAGG + Intronic
906934636 1:50201802-50201824 GTTAGGGGATGGGGGCAAGGGGG + Intronic
907097044 1:51791442-51791464 GTCAGTGGAAGCTGGGAAGATGG - Intronic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
907380423 1:54082710-54082732 GTGAGGGGAGGGAGGAAGGAGGG + Intronic
907442729 1:54488884-54488906 GTCAGGGGCTGGAGCATAGACGG - Intergenic
907645715 1:56241166-56241188 CTCAGGGGACGGAGGCAGGAGGG + Intergenic
907783890 1:57593156-57593178 GTCAGGGGCTGGGGAGAAGGAGG - Intronic
907865521 1:58396118-58396140 GGCAGGGGAGGGAGGGGAGGGGG + Intronic
908379967 1:63588374-63588396 TTCAGGGGTAGGAGGGAGGAGGG + Intronic
909212037 1:72836258-72836280 GTCAGGGGTTGGAGGGCAAGGGG + Intergenic
909274127 1:73663412-73663434 ATCAAAGGGTGGAGGGAAGAAGG - Intergenic
909275869 1:73686142-73686164 GTCAGTGGATGGGGGGCAAAGGG - Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909453383 1:75823621-75823643 GTCAGTGGGTGGAGGGAAAGGGG - Intronic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
910369906 1:86504270-86504292 CGCAGAGGCTGGAGGGAAGAAGG - Intergenic
911090630 1:94014321-94014343 GACGGGGGAAGGAGGGAGGAGGG + Intronic
911800158 1:102126308-102126330 GCCAGGGGCTGAAGGGAAGGAGG + Intergenic
911925657 1:103828453-103828475 GCCAGGGGTTGGAGGGGAGAGGG - Intergenic
912073469 1:105842627-105842649 GTCAGGGGGTGGGAGGAGGAGGG - Intergenic
912749834 1:112277544-112277566 GGCAGGGGGTGGAGGGAAAGTGG + Intergenic
912964531 1:114226371-114226393 GGCAGGGGATAAAGGGAGGATGG + Intergenic
912967361 1:114248308-114248330 GTCTGGGGAAGAAGGAAAGAAGG - Intergenic
913098776 1:115544288-115544310 GCCAGGGAATGGTGGGAAGGAGG + Intergenic
913432014 1:118805635-118805657 ATCAAGGAATGGAGTGAAGAAGG - Intergenic
913491179 1:119381369-119381391 GGCAGGGGAGGGAGGGCTGATGG + Intronic
913561711 1:120027621-120027643 GTCAGGGGGTGGGGGGAAAGGGG - Intronic
913681826 1:121193335-121193357 GACAGGGGCAGGAGGGAATAGGG - Intronic
913962388 1:143350413-143350435 GTCATGGGGTGGGGGGAAGGGGG + Intergenic
914033661 1:143980961-143980983 GACAGGGGCAGGAGGGAATAGGG - Intergenic
914056743 1:144175989-144176011 GTCATGGGGTGGGGGGAAGGGGG + Intergenic
914122403 1:144790373-144790395 GTCATGGGGTGGGGGGAAGGGGG - Intergenic
914155785 1:145087011-145087033 GACAGGGGCAGGAGGGAATAGGG + Intronic
914282299 1:146187023-146187045 GTCAGGGGGTGGGGGGAAAGGGG - Intronic
914409849 1:147416250-147416272 GGCAGGGGATGAAGGAAGGAAGG + Intergenic
914543324 1:148637737-148637759 GTCAGGGGGTGGGGGGAAAGGGG - Intronic
914623297 1:149433275-149433297 GTCAGGGGGTGGGGGGAAAGGGG + Intergenic
914941036 1:152023289-152023311 GGCAGGGAACGGAGGGCAGATGG - Intergenic
915100370 1:153495032-153495054 GGCAGAGGAAGGAGGGAAAAGGG - Intergenic
915378754 1:155422017-155422039 ATTAGGGGTTGGAGGGAGGATGG - Intronic
915682300 1:157593082-157593104 GTCAGGGGTTGGAGGGCTGGGGG + Intronic
915704810 1:157833532-157833554 GTCAGGGGTTGGAGACAGGAAGG + Intronic
915731642 1:158058402-158058424 GGCAGGGCAGGGAGGGAGGAGGG - Intronic
915870623 1:159556156-159556178 GTCAGGGGATGGGGGGCTGGGGG + Intergenic
915940389 1:160115137-160115159 GTTTGGAGATGGAGGCAAGAGGG - Intergenic
915948764 1:160173746-160173768 GGCTGGGGATGGAGGGAACATGG - Intronic
916198137 1:162244148-162244170 GGCATGGGATGGAGGAGAGAAGG + Intronic
916303491 1:163302591-163302613 GCCAGAGGTAGGAGGGAAGAAGG - Intronic
916512141 1:165481870-165481892 GACAGGGGAGGGAGGGAGGGAGG + Intergenic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
916896544 1:169169201-169169223 GTCAGGGGGTGGGGGGGATAGGG + Intronic
917132655 1:171758412-171758434 ACCAGGGCATGGAGGGAAAATGG + Intergenic
917649750 1:177064688-177064710 GGCAAAGGATGGAAGGAAGAGGG + Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
918088987 1:181271517-181271539 TTCAAGGGCGGGAGGGAAGAAGG - Intergenic
919033531 1:192276428-192276450 GTCAGGGGTGGGTGGGGAGAGGG - Intergenic
919118968 1:193315306-193315328 GTCAGGGAAGAGAAGGAAGAAGG - Intergenic
919157302 1:193782605-193782627 GGCAGGGGATGAAGGGAGGTTGG + Intergenic
919203914 1:194395514-194395536 GTCAAGGAATGCAGGGAAGGGGG + Intergenic
919309626 1:195891836-195891858 GTCATGGGGTGGGGGGAAGGGGG - Intergenic
919449462 1:197753382-197753404 ATCAAGGGTTGGAGGTAAGAAGG + Intronic
920039743 1:203087678-203087700 GACAGGAAATGGAGGGAAGGAGG + Intergenic
920469142 1:206211848-206211870 GACAGGGGCAGGAGGGAATAGGG - Intronic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
920899142 1:210089024-210089046 GTCAGGGGATGGAGGGCTAGGGG - Intronic
920916199 1:210259948-210259970 GGCAGGGGAGGGGAGGAAGAGGG + Intergenic
921317352 1:213905131-213905153 GAGAGGTGAGGGAGGGAAGAAGG + Intergenic
921337021 1:214098393-214098415 GTGAAGGGTGGGAGGGAAGAGGG + Intergenic
921422635 1:214966141-214966163 CTTAGGGGTTGGAGGGAAGGTGG + Intergenic
921538136 1:216377950-216377972 AACAGGGGAGGGAGGGAAGGAGG + Intronic
921667567 1:217890958-217890980 GCCAGGAGATGGAGGAAGGAGGG + Intergenic
921947139 1:220894075-220894097 GTTAGGGAATGGAGTAAAGAGGG - Intergenic
922020836 1:221702695-221702717 GACAAGAGATGAAGGGAAGATGG + Intronic
922064045 1:222118759-222118781 ATCAGGGGGTGGGGGGAGGAAGG - Intergenic
922126996 1:222737531-222737553 GTCAGGGAATTGCAGGAAGAAGG + Intronic
922218129 1:223537577-223537599 GCCAGGGGCTGGAGGAATGAGGG - Intergenic
922315138 1:224434920-224434942 GTCAGGGGAGGGAGGCCAGCGGG + Intronic
922406703 1:225321816-225321838 GTCAGGGGAGGAAGGGTGGATGG - Intronic
922564692 1:226594017-226594039 GCAAGGGGCTGGAGGGATGAAGG + Intronic
922762864 1:228143187-228143209 GCCAGGGGCTGGGGGGAACAGGG + Intronic
922765999 1:228157081-228157103 GCCGGGGGCTGGAGGGAGGATGG + Intronic
922933491 1:229407673-229407695 GTCTGTGGAGGGAGGGAAGGAGG + Intergenic
923040159 1:230314174-230314196 GTCTGACGGTGGAGGGAAGATGG + Intergenic
923228024 1:231957279-231957301 GTTTGCGGAGGGAGGGAAGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923374392 1:233345578-233345600 GTCATGGGATGGGGGGCAGGGGG + Intronic
923433934 1:233950598-233950620 GTGGAGGGATGGAGGGAGGAGGG - Intronic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
923536652 1:234857769-234857791 GTCAGGGTCTGGAGGGAGTAGGG + Intergenic
923763805 1:236873264-236873286 ACCAGGGGATGGAGTGGAGAGGG + Intronic
924078670 1:240369136-240369158 GGCAGGAGGTGGAGGGAAGTGGG - Intronic
924099354 1:240587906-240587928 GTAAGGGACTGGAGGGAATAGGG - Intronic
924113036 1:240718577-240718599 GTGAAGGGAGGGAGGGAGGAAGG - Intergenic
924118864 1:240776375-240776397 GTCAGTGGAGGGAGGGAGGGGGG - Intronic
924257386 1:242195935-242195957 GTGAGGGGCTGAAGAGAAGAGGG + Intronic
924407737 1:243769007-243769029 GTCAGGAGATGAGGGGATGAGGG - Intronic
924618008 1:245630578-245630600 GTCAGGGGGTTGAGGGAAAGGGG + Intronic
924830750 1:247592280-247592302 GTCAGGGGATTGGGGGAAAGGGG - Intergenic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063102190 10:2960038-2960060 GTCAGGGGATGGGGGGCAAACGG + Intergenic
1063179466 10:3584762-3584784 GACGGGGGCTGGAGGGGAGAAGG - Intergenic
1063223790 10:3995312-3995334 GTCAGGGGCTGGGGGGTAAAGGG - Intergenic
1063462402 10:6223004-6223026 GCCCCGGGATGGAGGGAGGAGGG + Intronic
1063493943 10:6489705-6489727 GGCAGGGGAGGGAGAGGAGAGGG + Intronic
1063503083 10:6572134-6572156 CTCAGGGGCTAGAAGGAAGAGGG - Intronic
1063576306 10:7265163-7265185 GGCAGGGGAGGGAGGGAAGGAGG - Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063917853 10:10902878-10902900 GGCAGGAGAGAGAGGGAAGAAGG + Intergenic
1064056709 10:12104007-12104029 TCCAGGGGCTGGAGGGAGGAAGG - Intronic
1064096511 10:12428167-12428189 GTCAGGGGATGGCGGGATAGGGG - Intronic
1064245737 10:13666378-13666400 GACAGGGGAGGGAAGGATGAGGG - Intronic
1064389291 10:14927583-14927605 GAAAGGAGAGGGAGGGAAGAAGG + Intronic
1064686337 10:17866263-17866285 GAAAGGGGAGGAAGGGAAGAAGG + Intronic
1064703976 10:18051176-18051198 GGAAGGGGATGGAGGGAGGGAGG + Intergenic
1064731349 10:18334184-18334206 AGCAGGGGATGGAAGGAAGTTGG + Intronic
1064788929 10:18933705-18933727 GTCAGGGGGTGGAGGGCAAGGGG - Intergenic
1064796471 10:19017292-19017314 GTCAGGGGAATGAGGAAAGAGGG + Intergenic
1064804689 10:19117124-19117146 GTGAGAGGAGAGAGGGAAGAAGG + Intronic
1064958430 10:20937450-20937472 GCCAGGGGGTGGAGACAAGATGG + Intronic
1065118798 10:22508201-22508223 GTCAGGGGATGGGGGGCTGGGGG - Intergenic
1065223418 10:23518934-23518956 GACAGGGGAGGGAAAGAAGATGG - Intergenic
1065302185 10:24332885-24332907 GGCAGGGGTAGGAGGGAAGGAGG + Intronic
1065814861 10:29474170-29474192 GTCAGGAGCTGGAAGGAAGGTGG - Intronic
1066122547 10:32303629-32303651 GTCAGGGGATGGGGAGAGGCAGG + Intronic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1066228735 10:33411284-33411306 GTCAGGGGAGGGTGGGGGGAGGG - Intergenic
1066242477 10:33551739-33551761 GTCAGGGGCTGGAGGGTGGGAGG - Intergenic
1066658215 10:37713842-37713864 GGCTGGGGAGGGAGGGAAGTGGG - Intergenic
1067127029 10:43527311-43527333 GTCAGGGGATGGGGGGCTGGGGG - Intergenic
1067346075 10:45440057-45440079 AGCAGGGCAAGGAGGGAAGAGGG + Intronic
1067474918 10:46558533-46558555 GCCAGGGCATGAATGGAAGAAGG - Intergenic
1067509262 10:46881799-46881821 ATCAGGAGATGGATGGATGAAGG - Intergenic
1067652990 10:48170056-48170078 ATCAGGAGATGGATGGATGAAGG + Intronic
1067702575 10:48584340-48584362 GCCAGGGTATGGATGGAAGAGGG - Intronic
1067833205 10:49621988-49622010 GGAAGGAGATGGAAGGAAGAGGG + Intronic
1068013654 10:51486243-51486265 GTCAGGGGATGGGGGAAAGGGGG - Intronic
1068467894 10:57418419-57418441 GTCATGGGGTGGAGGGCAGGGGG + Intergenic
1068529267 10:58166352-58166374 GCCAGGGACAGGAGGGAAGAGGG - Intergenic
1069260468 10:66387941-66387963 GTCAGGGGATGGAGGGCTGGGGG + Intronic
1069629816 10:69890595-69890617 GCCAGGGCATGGAGGGAGGCAGG + Intronic
1069675314 10:70242426-70242448 GTCAGGGCCTGGAAGGAAGGAGG + Intergenic
1070148804 10:73792853-73792875 GTGAGGGGATGGAAGGAGGGAGG + Intronic
1070160414 10:73863445-73863467 GTCCAGGGATGGAAGGAAGGTGG - Intronic
1070456072 10:76618896-76618918 GTTAGGGGATGGGGAGAGGAAGG + Intergenic
1070718572 10:78740286-78740308 GTCAGGGGCTGGTGAGGAGATGG + Intergenic
1070829686 10:79410799-79410821 GTCTGGGGATGGGTGGCAGAGGG + Intronic
1070852406 10:79576324-79576346 GTCATGGGGTGGGGGGAAGGGGG + Intergenic
1070959480 10:80488541-80488563 GACAGGGGAGGGAGGGAGCAGGG + Intronic
1071391379 10:85178434-85178456 GGCAAGGGAGGGAGGGAAGGAGG + Intergenic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1072100730 10:92226869-92226891 GGGAAGGGATGGAGGGAACAGGG + Intronic
1072391579 10:94992935-94992957 ATCAGGGGCTGGAGGCCAGAAGG + Intergenic
1072498566 10:95988695-95988717 TTCAGGAGATGAAGGGATGAAGG + Intronic
1072636500 10:97181771-97181793 GTCCGAGGATGGAGGGAGGCAGG - Intronic
1072637361 10:97186427-97186449 GTCGGGGGATGGGGGGAAACGGG - Intronic
1073047077 10:100645837-100645859 GGCAGGGGATTGCGGGAGGATGG - Intergenic
1073055517 10:100698295-100698317 ATCGGAGGATGGAGGGAAGTTGG - Intergenic
1073182190 10:101590784-101590806 GCCAGGGGATGGGAGGAGGAGGG - Intronic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1073404733 10:103287248-103287270 GACTGGTGAGGGAGGGAAGAAGG + Intronic
1073505974 10:103990170-103990192 GCCAGGGGTTGGAGGAAGGAGGG + Intronic
1073667093 10:105545788-105545810 GTCAGTGAATGGAGGAAGGAAGG + Intergenic
1073692943 10:105831613-105831635 GTGAGGGGAAGGAAGAAAGAAGG + Intergenic
1073926774 10:108525605-108525627 GTCAGGGGCTGGAGAGAAATAGG + Intergenic
1073998489 10:109342898-109342920 GTCAGGGCATAGAGGGCAAAAGG + Intergenic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1074506804 10:114078091-114078113 GGCAGGGGCAGGAGGTAAGATGG - Intergenic
1074643330 10:115414361-115414383 GTAAGGGGAAGAAGAGAAGAGGG - Intronic
1074801527 10:117005317-117005339 TTCAGGGGGTGGAGGAACGAGGG + Exonic
1075169828 10:120103076-120103098 GGAAAGGGATGGAGGAAAGAGGG - Intergenic
1075535356 10:123266986-123267008 GTCAGGGGCTGGGGGGAGGAGGG - Intergenic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1075721230 10:124588802-124588824 GTCAGAGGAGGGAGGGGACAAGG - Intronic
1075723668 10:124601025-124601047 GGCAAGGGTTGGAGGGAGGAAGG + Intronic
1075965481 10:126607977-126607999 GTCAGGGGAAAGAGGGAATGGGG + Intronic
1075968509 10:126633187-126633209 GGCAGTTGATGGAGGGAGGATGG - Intronic
1075999502 10:126904278-126904300 GTCAGGGATTGGAGGAACGAAGG - Intergenic
1076187078 10:128458413-128458435 GGCAGGGGATGCTGGGAAGGAGG + Intergenic
1076655394 10:132020187-132020209 GACAGGGGAGGGAGGGAGGGAGG - Intergenic
1077047297 11:552204-552226 CTCAGGGCCTGGAGGGAACATGG + Exonic
1077055090 11:587680-587702 GTCAGGGGCAGGAGAGAGGATGG + Intronic
1077287740 11:1775306-1775328 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287881 11:1775740-1775762 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077422935 11:2461434-2461456 TGCAGGGGAGGAAGGGAAGAGGG - Intronic
1077556792 11:3229911-3229933 GGGAGGGGATGGAGGGAGGCTGG - Intronic
1077660277 11:4061967-4061989 GGCAGGGGTTGGTGGGAGGAGGG + Intronic
1077664821 11:4098369-4098391 GGGAGGGGAGGGAGGGAGGAGGG - Intronic
1078031233 11:7753405-7753427 GTCGGGGGATGGGGGGCAGGGGG + Intergenic
1078088119 11:8246935-8246957 GTCTGGGGAAGGAGGTAAGGGGG - Intronic
1078198461 11:9156825-9156847 GAAAGGGGAAGGAGGGAAGGAGG + Intronic
1078459023 11:11499396-11499418 GTCAGGGGTGGGAGGGCAGTGGG - Intronic
1078630383 11:12998019-12998041 ATCAGGGGCTGGAGGGAAGGAGG - Intergenic
1079178567 11:18167937-18167959 TTCAGGGGAAGGATGGAAGAGGG + Intronic
1079188681 11:18259638-18259660 GTTAAGGGATGGAGGCAAGGAGG + Intergenic
1079477657 11:20848307-20848329 GTCAGGGGATGGTGGGACCAGGG + Intronic
1079482747 11:20898416-20898438 GTCATGGGGTGGGGGGAAGGGGG + Intronic
1079693278 11:23446424-23446446 GTCATGGGGTGGAGGGAGGGGGG + Intergenic
1080146450 11:28990671-28990693 GGTGGGGGAGGGAGGGAAGAAGG + Intergenic
1080709538 11:34733835-34733857 GCCAGTGGATGGAGGGAGCAAGG + Intergenic
1081081060 11:38739888-38739910 GTCAGGGGATGGGGGGAAAGGGG - Intergenic
1081313759 11:41605208-41605230 GTCAGAGGGTGGAGGGATGGGGG + Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081651587 11:44827501-44827523 GCCAGGGCAGGTAGGGAAGATGG + Intronic
1081787543 11:45757833-45757855 GGAAGAGGATGGAGGGAGGATGG + Intergenic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082913584 11:58405593-58405615 GTCAGAGGATGGTGGGTAGGAGG + Intergenic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083333751 11:61911306-61911328 GGCAGGAGCAGGAGGGAAGAAGG + Intronic
1083361607 11:62112580-62112602 GCCAGGGGAGTGCGGGAAGAGGG - Intergenic
1083594943 11:63914736-63914758 GTCAGGGAATGGGGTGAAGTTGG + Exonic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1083865006 11:65448931-65448953 GTCAGCAGGAGGAGGGAAGATGG - Intergenic
1083911390 11:65712249-65712271 GGCAGTGGAGGGAGGGAAGATGG + Exonic
1083912471 11:65718293-65718315 GGCAGGGGATGCAGAGAAAATGG - Exonic
1083913027 11:65720976-65720998 GAGAGGGGAGGGAGGAAAGAGGG - Intergenic
1084021874 11:66422601-66422623 GACAGTGGATGGTGGGGAGAAGG - Intronic
1084089370 11:66870173-66870195 GACTGGGGATGGGGAGAAGAGGG - Intronic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1084751116 11:71204991-71205013 GGCAGGTGAGGGAGGGAGGAGGG - Intronic
1084889529 11:72229909-72229931 TTCAGGGCCTGGAGGGAACAAGG - Exonic
1084907966 11:72363204-72363226 GGGAGGGGACGGAGGGAAGGAGG + Intronic
1085125908 11:74002216-74002238 GCAAAGGCATGGAGGGAAGAGGG - Intronic
1085135557 11:74084289-74084311 GTCATGGGGTGGAGGGCAGGGGG + Intronic
1085174011 11:74471079-74471101 GGCAGGGGATGGAGGTAGGGAGG - Intergenic
1085283721 11:75346714-75346736 GCCTGGGTATGGAGAGAAGAGGG - Intronic
1085339090 11:75719699-75719721 GGCAGGGGATGGAGTGAATTAGG + Intronic
1085344885 11:75762230-75762252 GCCAGGGGATGCACTGAAGACGG - Intronic
1085746415 11:79118558-79118580 GCCAGGGTCTGGAGGGAAGGGGG - Intronic
1085753389 11:79183383-79183405 GCCAGGGATTGGAGGGAGGAAGG + Intronic
1086124694 11:83338407-83338429 GACTGGGGAGGGAGGGAGGAAGG + Intergenic
1086124900 11:83340382-83340404 GTGAGGGCAAGGAGTGAAGAGGG - Intergenic
1086603775 11:88668808-88668830 GCCAGGGGTTGGGGGGATGAAGG - Intronic
1086854318 11:91848394-91848416 GTCATGGGGTGGAGGGATGGGGG - Intergenic
1086889965 11:92246124-92246146 GGCAGTGGATGGAGTGAAGAGGG + Intergenic
1087332626 11:96800156-96800178 ATCAGAGGGTGGAGGGTAGAGGG - Intergenic
1087509543 11:99073544-99073566 GTCAGGGGATGGGGGGACAAGGG - Intronic
1087553790 11:99688752-99688774 GTCAGAGGGTGGCGGGGAGAAGG - Intronic
1087903703 11:103671333-103671355 CTCAGGGGATTGTGGGGAGAGGG - Intergenic
1088072073 11:105799406-105799428 GTCAGTTGCTGGAGGGAAAATGG + Intronic
1088280068 11:108126574-108126596 GTCAGGGGAGGCAGGGAACTAGG + Intronic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088735338 11:112723760-112723782 GGCAGGGGTTGGAGGGTGGATGG + Intergenic
1088782099 11:113145760-113145782 CTCAGGGGGTGGAGGAAAGTGGG - Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089032800 11:115350382-115350404 TTAAAGGGAAGGAGGGAAGAAGG + Intronic
1089069277 11:115686948-115686970 GGAAGGAGAGGGAGGGAAGATGG + Intergenic
1089119309 11:116122350-116122372 GTCAGGGGCTGGAGGAGAAAGGG + Intergenic
1089162740 11:116452086-116452108 GGGAGGGGATTGAGAGAAGATGG - Intergenic
1089322447 11:117635535-117635557 GTCAGGGGAAGGAGGGGACGAGG + Intronic
1089706079 11:120278760-120278782 GTCAGGGGGTGGAGGGCAAGGGG + Intronic
1089827380 11:121291029-121291051 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1090400178 11:126443867-126443889 GTCAGGCTATGGTGGGAACAGGG + Intronic
1090437450 11:126698497-126698519 GTCAGGGGCTGCAGGGAGAAAGG + Intronic
1090456453 11:126854385-126854407 GTCAGGGGCTGGAGGTAATGGGG - Intronic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1091157662 11:133388412-133388434 GTCAGGGGAAGGAGGGCCTATGG + Intronic
1091393436 12:139392-139414 GTCCTGGGAGGGAGGGAAGGAGG + Intronic
1091865288 12:3829112-3829134 GACAGGGAATGGAGGGGCGAGGG + Intronic
1091958097 12:4665248-4665270 GCCAGGGGCTGGGGGGAAGGAGG - Intronic
1091992362 12:4965824-4965846 GTCAGGGGTTGGGGTGAAGGAGG - Intergenic
1092072284 12:5641220-5641242 GTCAGGGGGTGGGGGGCAGGGGG + Intronic
1092326199 12:7534021-7534043 GTCATGGGGTGGAGGGAGGGGGG + Intergenic
1092394175 12:8110709-8110731 GTTAGGGGATGGGGGAAGGAAGG - Intergenic
1092731258 12:11537106-11537128 GTCAGGGGATCGGGGGAAAGGGG + Intergenic
1093221626 12:16427279-16427301 AACAGGGGATGAAGGGCAGAGGG + Intronic
1093231093 12:16542910-16542932 ATCAGAGGATGGAGGGAATGTGG - Intronic
1093632459 12:21425538-21425560 GTCAGTGGGGAGAGGGAAGAAGG - Intergenic
1093802909 12:23394971-23394993 GTCATGGGGTGGGGGGAAGGGGG + Intergenic
1094006245 12:25754977-25754999 GTCAGGAGATGGAGGGAGACAGG - Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095807789 12:46339700-46339722 GTTAGGGGAAGGGGGGAAGGGGG - Intergenic
1095962967 12:47846810-47846832 TGCAGGGGAGGGAGGGAAGGAGG + Intronic
1096155499 12:49339331-49339353 GTGAGTGGAGGGAGGGAAAAGGG - Intergenic
1096177954 12:49535380-49535402 GTTGGGGGCTGGAGGAAAGATGG + Intergenic
1096230287 12:49893030-49893052 GTAGTGGGGTGGAGGGAAGAGGG - Intronic
1096861564 12:54532430-54532452 GTAGGGGGATGGAGAGAAGTGGG + Intronic
1096884209 12:54700230-54700252 AGCAGTGGATGGAGGGAATAGGG - Intergenic
1096938335 12:55309006-55309028 GTCAGGGGGTGGTGGGAAAGGGG + Intergenic
1096963619 12:55605699-55605721 GTCAGAGGATGGAGGGTGGGAGG + Intergenic
1097723711 12:63050831-63050853 ATCAAGGGAAGGAAGGAAGAGGG - Intergenic
1097952191 12:65443863-65443885 GCCAGGGGATGGTGGGAAGATGG - Intronic
1098033431 12:66278276-66278298 TCCAGGAGATGGAGGGAAGTGGG + Intergenic
1098176572 12:67798377-67798399 GGCAGAGGAGGGAGGGAGGAGGG - Intergenic
1098349863 12:69547194-69547216 GTCAGGGGATAGGGGGAGGAGGG + Intronic
1099330603 12:81280454-81280476 ATCAGTGGCTGGAGTGAAGATGG - Intronic
1099870816 12:88347153-88347175 GTCATGGGGTGGAGGGCAGGGGG - Intergenic
1099959193 12:89380442-89380464 GGAATGGGAAGGAGGGAAGAGGG - Intergenic
1100003054 12:89860519-89860541 GCCTGGGGATGGAGTGAGGAAGG + Intergenic
1100077251 12:90800671-90800693 GTCATGGGGTGGTGGGAAGGCGG + Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100276889 12:93079737-93079759 ACCAGGGGCTGGGGGGAAGAGGG + Intergenic
1100377509 12:94031154-94031176 GGCCGGGGATGGAGTGAGGAAGG - Intergenic
1100435240 12:94565234-94565256 GTCAGGACATGAAGTGAAGAGGG + Intergenic
1100463992 12:94828855-94828877 GTCATGGGGTGGCGGGAGGAGGG + Intergenic
1100877192 12:98975004-98975026 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1100955394 12:99902569-99902591 TTAAGAGGATGGATGGAAGAGGG + Intronic
1101183107 12:102241238-102241260 GTCATGGGGTGGAGGGATGGTGG + Intergenic
1101288302 12:103339352-103339374 TTCAGAGGGTGGAGGGTAGAAGG - Intronic
1101432062 12:104634931-104634953 ATCAAGGGAAGGAGGGAGGAAGG + Intronic
1101495701 12:105252145-105252167 GCCAGGAGCTGGAGGGAGGAGGG + Intronic
1101748792 12:107565597-107565619 GTCAGGAGATGGAGGGGTGCAGG - Intronic
1101776127 12:107795648-107795670 ATCAGAGGTTGGAGGGAAGAGGG + Intergenic
1101795947 12:107973946-107973968 GTCAGGGGATGGAGGAAGTTGGG - Intergenic
1101811198 12:108109432-108109454 GTCAGGGGCTGGGGGGAAAAGGG - Intergenic
1101954697 12:109203017-109203039 GCCAGGGGCTGGAGGGAGGAGGG - Intronic
1102227285 12:111237707-111237729 GGCAGGGGCTGGAGAGCAGATGG - Intronic
1102317205 12:111898834-111898856 GTCAGGGGGTGGGGGGAAGGGGG - Intergenic
1102395623 12:112583519-112583541 ATAAAGGGATGGAAGGAAGAAGG + Intronic
1102514588 12:113437855-113437877 ATCGGGGGATGGAGAGAGGAAGG - Intronic
1102527870 12:113524731-113524753 GTCAAAGGATTGAGGGCAGAGGG + Intergenic
1102696594 12:114804487-114804509 GCCTAGGGCTGGAGGGAAGAGGG - Intergenic
1102890344 12:116553789-116553811 GCCAGGAGTTGGAGGGATGAGGG + Intergenic
1102902135 12:116647102-116647124 GGAAGGGGAGGGAAGGAAGAGGG - Intergenic
1103017816 12:117509259-117509281 GGAAGGGGATGGAAGGAGGAGGG - Intronic
1103023465 12:117555096-117555118 GTGAGGGGTAGGAGGGAGGAAGG - Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103371559 12:120423295-120423317 GGAAGGGGAGGGAGGGAAGGAGG - Intergenic
1103564771 12:121810159-121810181 TTCCGGGGGTGGAGGGAAGTGGG - Exonic
1103840244 12:123857866-123857888 GCCAGCGGAGGGAGGGGAGAAGG - Intronic
1104074152 12:125374620-125374642 GTCGGGGGGTGCAGGGCAGAGGG - Intronic
1104248157 12:127062579-127062601 GGGAGGGGATGGATGGAAGGAGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105226753 13:18442071-18442093 GTCAGGGGTTGGAGGGGAAGAGG + Intergenic
1105424827 13:20285162-20285184 TTCTGGGGATCGAGGGAAGGAGG + Intergenic
1106011282 13:25825937-25825959 GACAGAGGATGGAGGGAATTGGG + Intronic
1106072411 13:26425107-26425129 TTAAGGTGATGGAGGGAGGATGG + Intergenic
1106090756 13:26591180-26591202 GTTAGGGGAGGGAAGGAAGCAGG + Intronic
1106353512 13:28956944-28956966 GTTGGGGGACAGAGGGAAGAAGG + Intronic
1106469015 13:30038420-30038442 GTCAGGAGATGTGTGGAAGACGG - Intergenic
1106597171 13:31154909-31154931 GGAAGGGGAAGGAGGGAAGGGGG + Intronic
1106961514 13:35003930-35003952 GTCAGGGTAGGGTGGGAGGAGGG - Intronic
1107284821 13:38779223-38779245 GTCGGGGGGTGGAGGGAAAGGGG + Intronic
1107457842 13:40571218-40571240 GTCATGGGGTGGGGGGAAGGGGG + Intronic
1108147116 13:47489677-47489699 GTTAGCGGATGGAGGGTAGGAGG + Intergenic
1108482310 13:50886426-50886448 GTTCAGGGATGGAGGGAAGAGGG + Intergenic
1108804268 13:54134459-54134481 GTCATGGGGTGGAGGGATCAGGG + Intergenic
1108812690 13:54248189-54248211 GTCATGGGGTTGGGGGAAGAGGG + Intergenic
1109536204 13:63722979-63723001 GTGAGAGGAAGGAGGGGAGATGG + Intergenic
1109539896 13:63763307-63763329 GTGAGAGGAAGGAGGGGAGATGG - Intergenic
1109805090 13:67429263-67429285 TTCAGGCCATGAAGGGAAGAGGG + Intergenic
1109890512 13:68605765-68605787 GTCAGGTGCTGGAGGGAATGGGG + Intergenic
1110129434 13:71988915-71988937 GTCAGGGGAGGGTGGGGAGAGGG + Intergenic
1110151867 13:72265625-72265647 GTCATGGGGTGGGGGGAAGGGGG - Intergenic
1110522499 13:76497213-76497235 GACAGGGGAAGGAGAGGAGAGGG + Intergenic
1110545576 13:76751650-76751672 GTCAGGGGAAGCAGGGAAGGAGG - Intergenic
1110661594 13:78064260-78064282 GTCAGGGGATGGATGGGGGAGGG - Intergenic
1110907565 13:80911815-80911837 GTCAGGGGTTGGAGGCTAGGGGG - Intergenic
1111137026 13:84060723-84060745 GTCAGGGGTTGGGGGGAAAGGGG + Intergenic
1112024698 13:95401336-95401358 GTTATGGGAAGGAGAGAAGAGGG + Intergenic
1112260574 13:97874367-97874389 CTCAGGGGTTAGAGGCAAGATGG + Intergenic
1112311366 13:98320112-98320134 GTCTGCAGATGAAGGGAAGACGG - Intronic
1112659522 13:101491770-101491792 GTCAGGGGGTGGAGGGCTAAGGG - Intronic
1112761364 13:102696920-102696942 GGCAGGGCAGGGAGGGAACAGGG + Intergenic
1113590335 13:111494392-111494414 GGCAGGGCATGGAGGGATGGAGG + Intergenic
1113593533 13:111516771-111516793 GACAGGGGAGGGAGGGAAGGAGG - Intergenic
1113600250 13:111563375-111563397 GTGAGGGGAGGGAGGGAAAGAGG - Intergenic
1113600276 13:111563450-111563472 GTGAGGGGAGGGAGGGAAACAGG - Intergenic
1113848472 13:113405087-113405109 GCCCGGGGATGCGGGGAAGAGGG - Intergenic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1114011209 14:18370558-18370580 GTCAGGGGTTGGAGGGGAAGAGG + Intergenic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114523509 14:23352997-23353019 CCCAGGGGAGGGAGGGAAGGGGG + Intergenic
1114563960 14:23614546-23614568 GACAGGGGATGGTGGGAAGTGGG + Intergenic
1114630276 14:24155127-24155149 GTGAGGGGTTGGAGGGGAGGGGG - Intronic
1114660997 14:24344809-24344831 GGCAGGGGGTGGAAGGAAGGGGG - Intergenic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1115197631 14:30818536-30818558 GTTAGGGGATGGAGGGATTGAGG + Intergenic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1115518475 14:34209059-34209081 TGCAGGGGAGGGAAGGAAGAGGG - Intronic
1115842239 14:37484988-37485010 GTCAGGGGGTGGAGGGGAAGGGG - Intronic
1116466612 14:45240645-45240667 GACAGGGGATAAAGGAAAGATGG + Intronic
1116747292 14:48836886-48836908 GGGAGGGGAGGGAGTGAAGAGGG - Intergenic
1116757526 14:48966273-48966295 GAGAGGGGAAGGAAGGAAGAAGG - Intergenic
1117090760 14:52247752-52247774 GTCAGGGGATTGAGTGAACATGG + Intergenic
1117353011 14:54899810-54899832 GTCAGGGACTGGCGAGAAGAGGG - Intronic
1117429571 14:55642328-55642350 GGCAGGGGATGGAGATGAGATGG - Intronic
1117517322 14:56514733-56514755 GCCAGGGGCTGGTGGGAGGAGGG + Intronic
1117726742 14:58682232-58682254 GCAAAGGGAGGGAGGGAAGATGG - Intergenic
1117932464 14:60857719-60857741 GTCAGGGGATGGGGGGCTGGGGG - Intronic
1118095055 14:62527033-62527055 ATCAGAGGATGGAGGGTGGAAGG + Intergenic
1118387895 14:65271894-65271916 GTGAGGGGTGGGAGGGAACAGGG - Intergenic
1118545250 14:66879203-66879225 GTCAGGGGATGGAGGGTTAGGGG + Intronic
1119447133 14:74674865-74674887 GCCAGGGAAGGGAGGCAAGATGG + Intronic
1119505260 14:75167368-75167390 GGCAGGGGAGGGAGGAAGGAAGG - Intronic
1119686518 14:76636984-76637006 GCCAGGAGATGGAGTGAGGAGGG + Intergenic
1119891200 14:78183479-78183501 GCCAGGAGAAGGAGGCAAGAAGG + Intergenic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1120222374 14:81748852-81748874 GTCAGTGGATTGGGGGAAGCGGG - Intergenic
1120462381 14:84813958-84813980 GTCATGGGGTGGGGGGAAGGGGG - Intergenic
1120689204 14:87574051-87574073 TTCAGGAGAGGGAGGGAATACGG - Intergenic
1120948592 14:90020639-90020661 GGCAGGGGAGGGAGGGAGGAAGG - Intronic
1120995112 14:90411641-90411663 ATTAGGGGATGGGGGGAAGGAGG - Intergenic
1121109103 14:91300310-91300332 ATCAGGGCATGGAGGGACTATGG - Intronic
1121336110 14:93078446-93078468 GTCGGGGGTTTGAGGGAAGGTGG - Intronic
1121342014 14:93111045-93111067 GCCCAGGGATGGAGGGATGAGGG - Intronic
1121507993 14:94490977-94490999 GTATGGGGATGGAGTGAAGGTGG - Intronic
1121888135 14:97563339-97563361 GACAGGGGATGCAGGAGAGATGG - Intergenic
1121895102 14:97639662-97639684 GTGAGGGAAGGGAGGCAAGAAGG - Intergenic
1122119751 14:99545945-99545967 GTCAGGGGCAGGAGGGTAAAGGG - Intronic
1122126329 14:99580465-99580487 GTGAGGGGAGGGGGGGAAGGGGG + Intronic
1122140948 14:99662747-99662769 GTGGAAGGATGGAGGGAAGAAGG + Intronic
1122286546 14:100655811-100655833 GTCAGGAGATGGAGGCTAAAGGG - Intergenic
1122384979 14:101338495-101338517 GGCAGGGGAAGGATGGAAGACGG + Intergenic
1122546533 14:102525909-102525931 GTCAGGGGAAAGAAGGAGGAAGG - Intergenic
1122886781 14:104713773-104713795 GTGAGTGGAGGGAGGGATGAGGG - Intronic
1122915586 14:104856900-104856922 GTGAGAGGAGGGAGGGAAAAAGG - Intergenic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1123201847 14:106673645-106673667 GTCATGGGGTGGCGGGAAGGGGG + Intergenic
1123626321 15:22229198-22229220 GTCAGGGGCCAGAGGGATGAGGG + Intergenic
1124097702 15:26664410-26664432 GACAGGGCATGGGAGGAAGAGGG + Intronic
1124365254 15:29066537-29066559 GTCAGGGGCTGGAGAGAGCAGGG + Intronic
1124604919 15:31162727-31162749 GAGAGGGGATGCAGGGATGAGGG + Intergenic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1125135961 15:36342887-36342909 GTCTGAGGATGGAGAGGAGAAGG + Intergenic
1125477707 15:40058624-40058646 CTCAGGGGAAGGAGAGGAGAGGG + Intergenic
1125602502 15:40923350-40923372 GTCAGAGAATGGAGGGCACAGGG - Intergenic
1125744087 15:41987377-41987399 TGCAGGGGAGGGAGGGATGAAGG + Intronic
1125889911 15:43258074-43258096 GTCGTGGGGTGGGGGGAAGAGGG + Intronic
1127365331 15:58284247-58284269 GTACGGGGATGGAGTGGAGAAGG + Intronic
1127542802 15:59959188-59959210 GTCAGGGGAAGGAGGGTCCAGGG - Intergenic
1127797687 15:62452600-62452622 GCCAAGGGCTGGAGGGAAGGAGG - Intronic
1127857095 15:62961927-62961949 GTCAGTGGATGGAAGGATGGAGG - Intergenic
1127919469 15:63481983-63482005 GCAGGGGGATGGAGGGAAAAGGG - Intergenic
1127972802 15:63974995-63975017 TTCAGGCCATGGTGGGAAGAGGG - Intronic
1127982920 15:64047169-64047191 GTGAGGGGGTGAAGGGAGGAAGG + Intronic
1127998697 15:64171331-64171353 TTCACAGGAGGGAGGGAAGAAGG + Exonic
1128165471 15:65460485-65460507 GTCAGGGACTGGATGGAAGGAGG - Intronic
1128445269 15:67754125-67754147 GCCAGGGACTGGAGGGGAGAAGG + Intronic
1128514827 15:68335655-68335677 GGGCCGGGATGGAGGGAAGAGGG - Intronic
1128518307 15:68358099-68358121 TACAGGTCATGGAGGGAAGATGG - Intronic
1128677822 15:69624691-69624713 GAGAGGAGAGGGAGGGAAGATGG - Intergenic
1129599444 15:76989753-76989775 GGCAGGGGCTGGAAAGAAGAGGG - Intergenic
1129612958 15:77074826-77074848 GTCTGGGGATGATGGGAGGATGG + Intronic
1129781368 15:78274167-78274189 GTCAGGGGAGGCAGGAATGAGGG - Intronic
1129933020 15:79428172-79428194 GGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1130068104 15:80622507-80622529 GCCAGGGGCTGGGGGAAAGAGGG + Intergenic
1130145439 15:81270464-81270486 GACAGGAGATGGAGGGAAAGAGG - Intronic
1130533552 15:84766539-84766561 GAGAGGGGAAGGAGAGAAGAGGG + Intronic
1130650140 15:85757834-85757856 GTCAGGGGTTGGAAGGAACCTGG - Intergenic
1130697431 15:86144658-86144680 GTCAGAGGATGGAGGGTAAGAGG + Intronic
1130712170 15:86294007-86294029 GTCAGGGGATGCAGTGCAGGTGG + Intronic
1130909670 15:88262393-88262415 GTTAGGGGAGCCAGGGAAGAGGG + Intergenic
1130956743 15:88632172-88632194 GTCTGGGGGTCGAAGGAAGATGG + Exonic
1131340859 15:91599267-91599289 GGCAGGGGGTGGAGGGGAGCAGG + Intergenic
1131360686 15:91788194-91788216 TTCGGGGGGTGGAGGGAAGTGGG - Intergenic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131413598 15:92232192-92232214 GTCTGTGGCTGGAGGGAGGAGGG + Intergenic
1131943255 15:97590792-97590814 ATCATGTGAAGGAGGGAAGATGG - Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132254527 15:100364308-100364330 GTCAGGGGATGGGGGGGCTAGGG + Intergenic
1132303525 15:100791090-100791112 GCCAGGGGCTGAGGGGAAGAGGG + Intergenic
1132327552 15:100984487-100984509 GCCAGGGGAGGGAGGGAGGGAGG - Intronic
1132827564 16:1912752-1912774 ATCAGGGGAGGGAGGGAGCAGGG - Intronic
1132977976 16:2719975-2719997 CTCAGGGGCAGGAGGGATGATGG + Intronic
1133028455 16:2998625-2998647 GGCAGGGGATAGAGGGATGTAGG - Intergenic
1133034551 16:3027562-3027584 GTCAGGACCTGGAGGAAAGAGGG - Exonic
1133215630 16:4290602-4290624 GTGAGCTGATGGAGGGGAGACGG - Intergenic
1133549748 16:6842816-6842838 GTCAGGGGGTTGGGGGAACATGG - Intronic
1133559872 16:6941225-6941247 GGGAGGGGATGGAGGGAGGGAGG - Intronic
1133614032 16:7459074-7459096 GTGAGTGGATGGATGGATGATGG + Intronic
1133656746 16:7872185-7872207 GACAGGGGAGGAAGGAAAGAAGG - Intergenic
1133678985 16:8102452-8102474 GTCAGGGGGTGGGGGGCAAAGGG + Intergenic
1134106160 16:11487033-11487055 GTCAGTGGATAGATGGAAGGAGG + Intronic
1134229459 16:12417652-12417674 GTAAGAGGAGGAAGGGAAGAGGG - Intronic
1134291744 16:12907154-12907176 GAAGGGGGATGGAGGGAAGGAGG - Intronic
1134488442 16:14677779-14677801 GTGGGTGGATGGATGGAAGATGG + Intronic
1134747642 16:16600484-16600506 AGCAGGGGAGGGAGGGCAGAGGG - Intergenic
1134782416 16:16910188-16910210 GTGAGTGGATGGAGGGAGGTAGG + Intergenic
1134784835 16:16932655-16932677 TTGAGGGGATAGAGGGAACATGG - Intergenic
1134819996 16:17239330-17239352 GTGAGTGGATGGATGGATGATGG - Intronic
1134997825 16:18753175-18753197 AGCAGGGGAGGGAGGGCAGAGGG + Intergenic
1135502298 16:23006966-23006988 GTCAGGAGAGGGAGGGATAAAGG + Intergenic
1135621601 16:23960620-23960642 GTCAGAGTGGGGAGGGAAGAGGG - Intronic
1135851515 16:25968073-25968095 TTCAGGGGAGGGAAGGGAGAGGG + Intronic
1135983753 16:27168588-27168610 GAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1136362855 16:29792344-29792366 GTCCAGGGTAGGAGGGAAGAGGG - Intronic
1136655600 16:31707259-31707281 GTCAGTGGAGGGTGGGAAGCTGG - Intergenic
1136730343 16:32405933-32405955 GGGAAGGGATGAAGGGAAGAAGG - Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137790065 16:51167488-51167510 GTCAGGGCACTGAGGGAACAGGG - Intergenic
1137875271 16:51990708-51990730 CTCAGGAGATGGAGGGTAGGAGG - Intergenic
1137937970 16:52653154-52653176 GTCATGGAATGGAGGGAGGGAGG - Intergenic
1138110768 16:54321980-54322002 GCCAGGGGCTGGAAGGAGGATGG + Intergenic
1138544190 16:57706292-57706314 ATCAGAGGATGGTGGGAGGATGG - Intronic
1138548753 16:57735787-57735809 GGCAGGGGATGGAGGCAAGTGGG + Exonic
1138634536 16:58326818-58326840 GCCAGAGGCTGGAGGGAGGAGGG + Intronic
1138757234 16:59503333-59503355 GTCAGGGGGTGGAGGGATAGGGG - Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139247250 16:65457135-65457157 ATAAAGGGATGTAGGGAAGAAGG - Intergenic
1139581300 16:67875353-67875375 GTCAGAGTTTGGAGAGAAGATGG - Intronic
1139946041 16:70642903-70642925 GCCAGGGGCTGGGAGGAAGAGGG + Intronic
1139959077 16:70707406-70707428 GAAAGGGGATGGAGGGAGGAGGG + Intronic
1140142028 16:72267223-72267245 CTCAGGTGAAGGAGGCAAGAAGG - Intergenic
1140172924 16:72626009-72626031 GGAAAGGGAAGGAGGGAAGAAGG + Intergenic
1140691354 16:77487536-77487558 GTCAGGGGATGGGGGGCAAGGGG - Intergenic
1140722785 16:77786503-77786525 GCCATGGGATGGAAGGAAGAGGG - Intergenic
1140800994 16:78488162-78488184 GGCTGGGGATGGAGGGAACATGG + Intronic
1140855712 16:78975928-78975950 ATCAGGGGATGGAGGGTGGCAGG - Intronic
1140914621 16:79482969-79482991 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140914673 16:79483104-79483126 GGGAGGGGAGGGAGGGAAGTAGG - Intergenic
1140914716 16:79483205-79483227 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140920670 16:79534583-79534605 GTCATGGGATGGGGGGAGGGAGG + Intergenic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141411672 16:83838375-83838397 GGAAGGGGAGGGAGGGAGGAAGG + Intergenic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141788712 16:86218541-86218563 GGCAGAGGTTGGAGGGATGAAGG + Intergenic
1141833363 16:86522232-86522254 GGAACGGGATGGAGGGAAGTGGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1141904675 16:87016423-87016445 GCCAGGGGTTGGGGGGAAGGCGG + Intergenic
1141977654 16:87528173-87528195 GTCAGGGGCCGGAGGGAGGAGGG - Intergenic
1142008209 16:87700472-87700494 GGCAGGGGGTAGAGGGAGGAGGG + Intronic
1142008217 16:87700493-87700515 GGCAGAGGGTGGAGGGAGGAGGG + Intronic
1142698615 17:1646684-1646706 GGCAGGGGATGGTGAGAAAAGGG + Intronic
1142958256 17:3535483-3535505 GGAAGGGGAAGGAGGGAAGAAGG - Intronic
1142977766 17:3655882-3655904 GGCAGGGGAGGAAGGGAGGAGGG + Intronic
1143367776 17:6419659-6419681 GTCAGGGGATGGGGGGAAAGGGG + Intronic
1143505403 17:7361907-7361929 GGCATGGTTTGGAGGGAAGATGG + Intergenic
1143508974 17:7384787-7384809 GAGAGCGAATGGAGGGAAGAGGG - Intronic
1143789989 17:9287155-9287177 GTCAGGAGATGGAAAGCAGATGG + Intronic
1144034190 17:11350591-11350613 GACAGTGGACTGAGGGAAGAGGG - Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144095173 17:11893706-11893728 GTCAGGGGGTGGAGGGGAAAGGG + Intronic
1144561002 17:16320276-16320298 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1144655837 17:17035951-17035973 TTCAGGGGATTGATGGATGATGG + Intergenic
1144805321 17:17962230-17962252 GCCAGGGGCTGGGGGGAGGAGGG + Intronic
1145059878 17:19725881-19725903 GTCAGGGGCTGGAGAGAAGGTGG + Intergenic
1145121497 17:20264381-20264403 GACAAGGGAGGAAGGGAAGAAGG - Intronic
1145733276 17:27209912-27209934 GGGAGGGGAGGGAGGGAAGCAGG - Intergenic
1146023101 17:29295469-29295491 ATCAAGGGATGGAAGGAGGAGGG - Intergenic
1146110951 17:30089085-30089107 GTCGTGGGGTGGAGGGAAGGGGG - Intronic
1146143233 17:30388112-30388134 GGCAGAGGATGGAGAGATGATGG - Intronic
1146378821 17:32313572-32313594 GCCAGGGGCTGGAGGGAGGAGGG - Intronic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146655203 17:34630899-34630921 GCCAGGGGAAGGAGGGAATCTGG - Intronic
1146700055 17:34949483-34949505 GGAAAGGGAGGGAGGGAAGAAGG + Intronic
1146719376 17:35113073-35113095 GGCAGGGCATGGAGGGTAGGTGG - Intronic
1146874677 17:36399152-36399174 GTCAGGGGATGGCGGGCAAGGGG - Intronic
1147064706 17:37913729-37913751 GTCAGGGGATGGCGGGCAAGGGG + Intergenic
1147153742 17:38532914-38532936 GTGAGGGGAAGGCGGGAAGGGGG + Exonic
1147323143 17:39657947-39657969 CCCAGGGGAGGGAGGGAGGAAGG - Intronic
1147487679 17:40833481-40833503 AGCAGGGGAGGGAGGGAAGCAGG - Intronic
1147980810 17:44272851-44272873 GTCTGGGGGTGGATGGAAGTGGG + Intergenic
1148086528 17:44996926-44996948 GAGAGGGGATGGTGGGAACACGG + Intergenic
1148243486 17:46014969-46014991 GTGAGGGGATGGTGGGGGGATGG + Intronic
1148468289 17:47877892-47877914 GTCTTAGGAGGGAGGGAAGAGGG - Intergenic
1148781396 17:50123996-50124018 ACCAGGGGAGAGAGGGAAGAAGG + Intronic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1148988802 17:51647457-51647479 GGAAGGGGAGGCAGGGAAGAAGG - Intronic
1149193487 17:54091591-54091613 GTCAGGGGGTGGAGGGTTGGGGG + Intergenic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1149284304 17:55145022-55145044 GCAAGGGGAGGGAGTGAAGAGGG - Intronic
1149482897 17:57017968-57017990 GGCAGAGGATGGAGAGATGATGG - Intergenic
1149744790 17:59086017-59086039 GCCAGGGGCTGGTGCGAAGAAGG + Intronic
1149979353 17:61297284-61297306 GGCTGGGGATGGAGGAGAGAAGG + Intronic
1150149661 17:62798849-62798871 GGCAGGGGCTGGAGAGCAGAGGG + Intronic
1150552232 17:66221366-66221388 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1150620669 17:66805812-66805834 GTCACAGGCTGAAGGGAAGAAGG - Exonic
1150679176 17:67270674-67270696 GTCAGGGGCTGGAGGAAGGATGG - Intergenic
1151133014 17:71917746-71917768 GGCAGAGGTTGGAGGGAAGGAGG - Intergenic
1151144761 17:72030581-72030603 GCTAGGGGAAGGAGGGAAGCAGG + Intergenic
1151417271 17:73974494-73974516 GACATGGGATGGATGGGAGAGGG - Intergenic
1151582967 17:74990594-74990616 CCCAGGAGAGGGAGGGAAGAAGG + Intronic
1151717904 17:75840701-75840723 GTTGGGGGATGGAGGGCAAAAGG + Intronic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1152013699 17:77735927-77735949 GTCAAGGGAGGGAGGGATGGAGG + Intergenic
1152219000 17:79050624-79050646 GGCAAGCGATGGAGAGAAGAAGG - Intergenic
1152227658 17:79100062-79100084 ATCAGGGAATGGAGGGAGGTGGG - Intronic
1152375289 17:79915709-79915731 GCCAGGGGCTGGAGGGTCGAGGG + Intergenic
1152382982 17:79951851-79951873 GGCAGGGGGTGGTGGGGAGAAGG - Intronic
1152913043 17:83016490-83016512 GAGAAGGGATGGAGGGAGGAGGG + Intronic
1153522010 18:5962441-5962463 GACAGGGAGTGGCGGGAAGAGGG + Intronic
1153790716 18:8577076-8577098 ATAAGGGGATGGAGGGATGGAGG - Intergenic
1153997394 18:10454412-10454434 GAGAGGGGAAGGAGGGAAGCGGG + Intergenic
1154137656 18:11794561-11794583 GCCAGGTGTTGGAGGGAAGAGGG + Intronic
1154526630 18:15297403-15297425 GTCAGGGGTTGGAGGGGAAGAGG - Intergenic
1155103547 18:22638500-22638522 GAGAGGGGAAGGAGGGAAGGAGG + Intergenic
1155149736 18:23113522-23113544 GCCAGGGGCTGGGGGGAGGAGGG - Intergenic
1155175251 18:23296089-23296111 GTCAGGGGATGGAGGGCTAGGGG + Exonic
1155507696 18:26548707-26548729 CGCAGGGGATGGAGGGGAGGGGG + Intronic
1155831185 18:30516386-30516408 GTCATGGGGTGGAGGGAGGGGGG + Intergenic
1156009825 18:32483789-32483811 GTGAGAGGAGGGAGGGAAGGGGG + Intergenic
1156068694 18:33177202-33177224 GTCAGGGGGTTGAGGGAAAGGGG + Intronic
1156256629 18:35404142-35404164 GTCATGGGGTGGAGGGATGGGGG - Intergenic
1156288486 18:35722672-35722694 GTCGTGGGGTGGGGGGAAGAGGG - Intergenic
1156392389 18:36662859-36662881 ACCAGGGGATTGAGGAAAGAGGG - Intronic
1157144133 18:45143981-45144003 GGCAGTGGAGGGAAGGAAGAGGG - Intergenic
1157239674 18:45997632-45997654 GGGAGGGGAGGGAGGGAAGGGGG - Intronic
1157310169 18:46546803-46546825 CACAGGGGAGGGAAGGAAGATGG + Intronic
1157337023 18:46748067-46748089 GTCAGGGGGTGGAGGGCTGGGGG + Intronic
1157523336 18:48360573-48360595 GCCAGGGGAGGGAGAGAACACGG + Intronic
1157817305 18:50738966-50738988 GTCAGGGGAGGGAGGGTATTAGG + Intergenic
1157964946 18:52197638-52197660 GTCAGGAGATGGGGAGAAGGTGG + Intergenic
1158091233 18:53716156-53716178 GTCAGGGGCTGGTGGGCAAAGGG - Intergenic
1158259139 18:55588246-55588268 GGGAGGGGACGGAGGGAAGGGGG + Intronic
1158391640 18:57049894-57049916 GGCAGGGGAGGTAGGGGAGATGG - Intergenic
1159004064 18:62997463-62997485 GTCAGAGTAGGGAGGGAAAAAGG - Intergenic
1159018331 18:63121406-63121428 TTCTGGGGATGGAGGAGAGAGGG - Intergenic
1159157708 18:64605863-64605885 GTCAGGGGGTGGGGGGAAAGAGG + Intergenic
1159506805 18:69348681-69348703 GTCAGGGGATGGGGGGCAAGGGG + Intergenic
1159514104 18:69435277-69435299 GTCAGGATATTGAGGGGAGAAGG - Intronic
1159581944 18:70242854-70242876 GTCGGGGGGTGGAGGGCAAAGGG + Intergenic
1159846467 18:73466939-73466961 GCTAGGGGATGAGGGGAAGAGGG + Intergenic
1159907559 18:74109825-74109847 GTCAGGGGATGGGGGGCTGGGGG + Intronic
1159927388 18:74281462-74281484 GACAGGAGGTGGAGGGAGGAGGG + Intronic
1160126243 18:76175054-76175076 GTAGAGGGATGGAGGGTAGAGGG - Intergenic
1160507946 18:79437678-79437700 GGCAGAGGGTGGAGGGCAGAGGG - Intronic
1160509839 18:79447232-79447254 GTCAGTGGGCAGAGGGAAGATGG - Intronic
1160667112 19:336057-336079 AGCAGGGGAAGGAGGGAGGAAGG + Intronic
1160917317 19:1503446-1503468 GACAGGGGAGGGAGGGCAGTGGG + Intergenic
1160997197 19:1888264-1888286 GGAAGGGGCTGCAGGGAAGATGG - Intergenic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161849377 19:6730831-6730853 GAGAAGGGATGGAGGGGAGATGG - Intronic
1161916092 19:7229283-7229305 GCAAGTGGATGGAGGGATGATGG + Intronic
1161934631 19:7364105-7364127 GTGAGTGGAAGGAAGGAAGATGG + Intronic
1162318272 19:9954490-9954512 CTCAGGAGGTGGAGGCAAGAGGG + Intergenic
1162444313 19:10712894-10712916 GGCAGGGCATGGAGGGGACAGGG + Intronic
1162523349 19:11194452-11194474 GTCAGGGGACTCAGGGAAGAGGG - Intronic
1162605160 19:11701161-11701183 GGCAGAGGATTCAGGGAAGATGG + Intergenic
1162614273 19:11784721-11784743 GTCAGAGGATTCAAGGAAGATGG - Intergenic
1162937624 19:13989258-13989280 GTGAGGGGATGGGTGGAAGTGGG + Intronic
1163054237 19:14706360-14706382 GTTGAGGGGTGGAGGGAAGATGG - Intronic
1163082340 19:14953085-14953107 GGGAGCAGATGGAGGGAAGAAGG + Intronic
1163108098 19:15139177-15139199 GTCAGGAGATGGAGGTCAGAAGG - Intergenic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163572213 19:18089180-18089202 GTCAGGGGCTGGGGGGAGGCGGG + Intronic
1164499816 19:28808629-28808651 GTCATGGGGTGGGGGGAGGAGGG + Intergenic
1164538531 19:29105361-29105383 GTCGGGGGTTGCTGGGAAGAAGG - Intergenic
1164592524 19:29514278-29514300 GTAAGGAGATGGGGGGATGAGGG + Intergenic
1164596590 19:29534268-29534290 GACAGGGAATGGAGGGCAGGAGG - Intronic
1164658345 19:29940900-29940922 GGCTGGGGATGGAGAGAGGATGG + Intronic
1164662947 19:29994430-29994452 ACCAGGGGATGGGGGGAGGAAGG - Intronic
1164740542 19:30572451-30572473 GTTAGGGAGTGGAGGGTAGAGGG - Intronic
1165059485 19:33198093-33198115 GTCAGGGGAAGGGGGAATGAGGG + Intronic
1165148838 19:33749441-33749463 GTGGGGGGATGGTGGGGAGATGG - Intronic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165245047 19:34493910-34493932 GGCAGGGGATGGAGGGGAGGAGG - Intronic
1165300098 19:34963401-34963423 GTAATGGGATGGAGGGAGAAAGG - Intronic
1165329474 19:35133661-35133683 GCCAGGGGATGGAGGCAGGTGGG - Intronic
1165448465 19:35869309-35869331 AGCAAGGGATGGAGGGAGGAGGG + Intronic
1165500393 19:36184626-36184648 GCCAGGGGCTGGAGGGAATAGGG - Intronic
1165971309 19:39633126-39633148 GTCATGGGGTGGAGGGATGGGGG - Intergenic
1166118891 19:40673264-40673286 GGCAAGGGATGGAGGCGAGATGG - Intronic
1166412907 19:42568525-42568547 GTCGTGGGGTGGAGGGAAGGGGG + Intergenic
1166571393 19:43799101-43799123 GTGAGAGGAAGGAGGGAAGGAGG - Intronic
1166892094 19:46000071-46000093 GTCAGCGGCGGGAGGGGAGAGGG + Intronic
1166948082 19:46409243-46409265 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167130412 19:47581876-47581898 GTCATGGGCTGGAGGGCAGGGGG - Intergenic
1167250121 19:48394947-48394969 GACAGGGGATGCAGGGATGGTGG + Intronic
1167490093 19:49787787-49787809 GCCAGGGGCTGGGGGGAAGAGGG - Intronic
1167798191 19:51724327-51724349 GATAGGGGATGGGGGGATGAGGG - Intergenic
1167944042 19:52973162-52973184 GTCAGGACATGGCAGGAAGATGG + Intergenic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1167980899 19:53274089-53274111 GTCATGGCTTGGAGGGAAGAGGG + Intergenic
1167985497 19:53311242-53311264 GTCACGGCTTAGAGGGAAGAGGG - Intergenic
1167993256 19:53378679-53378701 GTCAGGACATGGCAGGAAGATGG - Intronic
1168127393 19:54293374-54293396 AGCAGGTGCTGGAGGGAAGAGGG + Intergenic
1168156239 19:54474269-54474291 CGCAGGGGATGGAGTGAAGCAGG + Intergenic
1168172964 19:54601474-54601496 AGCAGGTGCTGGAGGGAAGAGGG - Intronic
1168434914 19:56309283-56309305 GTCAGGGGCTGAGGGGAGGAAGG + Intronic
925132217 2:1502066-1502088 CCCAGGGGATGGAGAGAAAATGG + Intronic
925222161 2:2150851-2150873 GGGAAGGGAAGGAGGGAAGAAGG + Intronic
925255947 2:2488233-2488255 GTCAGGAGCTGGTGGGAAGGGGG - Intergenic
925266335 2:2569074-2569096 GGCTGGGGCTGGACGGAAGAGGG + Intergenic
925434690 2:3826906-3826928 GGCAGGGGAGGGAGGGATGGAGG - Intronic
925719765 2:6815767-6815789 GTCAGAGGGTGGAGGGTGGATGG + Intergenic
925925719 2:8668548-8668570 ATGAGGGGATGGATGGATGAGGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926208587 2:10851725-10851747 GCCAGGGGCTGGAGGGAAGGAGG - Intronic
926232933 2:11018623-11018645 GGCAGGGTATGGCGGGGAGACGG - Intergenic
926242928 2:11101775-11101797 ATCAGGGGCTGAGGGGAAGAAGG + Intergenic
926337422 2:11875086-11875108 GTGAGGGGATGGGGGGGCGAGGG - Intergenic
926585392 2:14680264-14680286 GTCAGGGGGTGGAGGGCAAAGGG + Intergenic
926705864 2:15837046-15837068 GCCAGGGGCTGGAGGGAGGGAGG + Intergenic
927008477 2:18877424-18877446 ATCAGAGGGTGGAGGGTAGAAGG - Intergenic
927366578 2:22304350-22304372 GACAGGGGGTGGAGCCAAGATGG + Intergenic
927399904 2:22698711-22698733 GAGAGTGGATGGGGGGAAGATGG - Intergenic
927512105 2:23650195-23650217 CTCAGGGGCTGGAGAAAAGAGGG + Intronic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
927578883 2:24223767-24223789 GGGAGGGGAGTGAGGGAAGAAGG + Intronic
927608221 2:24508610-24508632 AAAAGGGGATGGGGGGAAGAGGG - Intronic
927634886 2:24806453-24806475 GTGAGGGGGTGGAGCCAAGATGG - Intronic
927646978 2:24884063-24884085 GTGAGAGGCTGTAGGGAAGAGGG - Intronic
928098973 2:28423744-28423766 ATCAGGAGAAGGAGGGAAGGTGG - Intergenic
928426090 2:31179216-31179238 GTCAGGGGGTGGGGGGCAGGGGG - Intronic
928458400 2:31446583-31446605 GCCAGGGGATAGGGGGAGGAGGG - Intergenic
928787225 2:34903223-34903245 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
929206781 2:39305040-39305062 GCCAGGGGCTGGAGGGAAAAAGG + Intronic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929476635 2:42257134-42257156 GTTAGGGGATGGTGGGCAGGAGG + Intronic
929737267 2:44563618-44563640 GTCATGGGGTGGGGGGAAGGGGG - Intronic
929761897 2:44814047-44814069 GTCAGGGAGTGGTGGAAAGAAGG + Intergenic
929913216 2:46111488-46111510 GTAAGGGGATGGAAGGACTAGGG - Intronic
930014414 2:46960485-46960507 GTAGGGGGATGGGGGGAAGCAGG + Intronic
930099625 2:47592872-47592894 GCCAGGGGATAGGGGGAGGAGGG + Intergenic
930330867 2:49981389-49981411 TGAAGGGGAGGGAGGGAAGAGGG + Intronic
930357147 2:50335513-50335535 GGCAGGGGGTGGTGGGGAGAGGG - Intronic
930358685 2:50350725-50350747 GGCAGGGGAGTGAGGGAGGAGGG - Intronic
930965572 2:57320006-57320028 GTCAGGGGATAGTGGGAGGTGGG + Intergenic
931024375 2:58092808-58092830 GTCATGGGGTCGGGGGAAGAGGG - Intronic
931090674 2:58882715-58882737 GTTGGGGGATGGGGGGAAAAGGG + Intergenic
931701199 2:64910435-64910457 GTCAGAGGCTGCTGGGAAGAAGG + Intergenic
931799826 2:65747676-65747698 GGCAGGGGAGGGAGGAAGGAAGG + Intergenic
931800451 2:65753125-65753147 GTCATGGGGTGGGGGGAGGAGGG - Intergenic
931829405 2:66035512-66035534 GTCAGGGGGTGGGGGGCAAAGGG - Intergenic
931905407 2:66837452-66837474 GTCAGGGAATGCAGGGAAGTGGG - Intergenic
932010902 2:67976495-67976517 GTCAGGGGTGGGAGGGGAGATGG + Intergenic
932476763 2:72011293-72011315 GTCAGAGCTTGGAGGAAAGAAGG - Intergenic
932851867 2:75195368-75195390 GGTAGGAGAAGGAGGGAAGAGGG - Intronic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
934063041 2:88314170-88314192 GCCAGGGGATGGGTGGCAGAAGG - Intergenic
934277392 2:91585703-91585725 GTCATGGGGTGGGGGGAAGGGGG + Intergenic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
934785294 2:97000781-97000803 GTCAGGGGGTGGAGGGCAAGGGG - Intronic
934880447 2:97972449-97972471 GGGAGGGGAGGGAGGGAAGGCGG + Intronic
934959333 2:98655152-98655174 GACAGTGGAGAGAGGGAAGAGGG + Intronic
935613191 2:105047480-105047502 GGAAGGGGATGGAGGTAGGAGGG + Intronic
935842655 2:107130159-107130181 GCCAGGGGCTGCAGGGAAGAGGG - Intergenic
935958817 2:108403779-108403801 ATCAGGGGCTGGAGGCCAGATGG - Intergenic
935999357 2:108811123-108811145 GGGAGGGGAAGAAGGGAAGAAGG - Intronic
936022801 2:109007636-109007658 GACAGGAGAGGCAGGGAAGAAGG + Intergenic
936326451 2:111509719-111509741 GTCAGGGGCTGGGGGGGAGGTGG + Intergenic
936492894 2:112989141-112989163 GTCAGGGGATGGGGGGTAAAGGG + Intergenic
936716232 2:115190600-115190622 ATCAGGGGCTGGAGGCCAGATGG + Intronic
937028534 2:118719061-118719083 GTCAGAAGAGGGAGGGAAAATGG + Intergenic
937146018 2:119645334-119645356 GCCAGGGGCTGGAGGGAGGTGGG - Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937264143 2:120605561-120605583 GTCAGGGGATGGATGTGAGAAGG - Intergenic
937299104 2:120827863-120827885 GCCAGGGGCCGGAGGGAGGAAGG + Intronic
937331495 2:121033051-121033073 GTCAGGGGTTGCAAAGAAGAAGG + Intergenic
937556377 2:123162708-123162730 GTGAGAGGAAGGAAGGAAGAAGG - Intergenic
938019379 2:127893582-127893604 GGCAAGGGGTGGTGGGAAGATGG - Intergenic
938684862 2:133728350-133728372 GTCATGGGGTGGGGGGAAGGGGG + Intergenic
938966349 2:136392070-136392092 GGCAGGGGAAGCAGGGAGGAGGG - Intergenic
939046757 2:137258830-137258852 GTCAGGGGTTGGGGGGGACATGG - Intronic
939733849 2:145819312-145819334 AGGAGGGGATGGAGGGAGGAAGG - Intergenic
939733892 2:145819439-145819461 GGGAGGGGATGGAGGGATGGAGG - Intergenic
939763295 2:146211634-146211656 GTCATGGGGTGGGGGGATGAGGG + Intergenic
940082469 2:149819693-149819715 GGAAGGGGATGATGGGAAGATGG - Intergenic
940242538 2:151578632-151578654 GGCAAGGGAAGGAGGGAAGGAGG + Intronic
940361114 2:152797166-152797188 TGCAGGGGATGCAGGGAAGTAGG + Intergenic
940478358 2:154195021-154195043 GTCAGGGGATGGAAGGCAAGGGG - Intronic
940533525 2:154908785-154908807 GTCAGGTCATGGAGGGAGTATGG - Intergenic
940745674 2:157564953-157564975 GTCAGGGGGTGGAGGGTAATGGG + Intronic
940905642 2:159167115-159167137 GTCAGGGGAAGAAGGGAAATAGG + Intronic
941238790 2:163011501-163011523 GTCAGGGCATGGGGGGAAAGGGG - Intergenic
941597208 2:167492133-167492155 TTCAGTGGAGGGAGAGAAGAGGG - Intergenic
941867239 2:170347906-170347928 GTCAGGGGCTGGAGGGGAGAAGG - Intronic
942021717 2:171872696-171872718 GCCAGGGAATGGAGGGAGAAAGG + Intronic
942062880 2:172244081-172244103 GGCAGGGGGTGAAGGGAGGAAGG - Intergenic
942245293 2:174002639-174002661 GCTAGGGTTTGGAGGGAAGAAGG + Intergenic
942287045 2:174429782-174429804 GCCAGGGGTTGGAGGGAGGGTGG - Intergenic
942335431 2:174879912-174879934 CACAGGGCATGAAGGGAAGATGG + Intronic
942342312 2:174961196-174961218 GGGAAGGGAGGGAGGGAAGAAGG + Intronic
942526323 2:176856733-176856755 TTCAGGGGACAGAAGGAAGAGGG - Intergenic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
942889135 2:180965541-180965563 GTCAGGGGGTGGGGGTAGGAGGG + Intergenic
943116964 2:183684621-183684643 GTCAGGGGGTGGTGGGAAAGGGG + Intergenic
943330124 2:186549214-186549236 GTTAGGGGAGGGAGGGTAGTGGG - Intergenic
943882284 2:193160972-193160994 GTCAGAAGATTGAGGGGAGAAGG + Intergenic
943986686 2:194630539-194630561 GTCATGGGATGGGGGGAGGGAGG + Intergenic
944063968 2:195599862-195599884 GTCAGTGGGTGGAGGGCAAAGGG - Intronic
944155007 2:196598513-196598535 GGGAGGGGATGGAGAGAGGAGGG + Intergenic
944211086 2:197207196-197207218 ATCATGGCATGGAGGGAAGGGGG + Intronic
944443378 2:199764859-199764881 GTCAGGGGGAGTAGGGAAGCGGG - Intronic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
944822444 2:203444080-203444102 GTGAGGGGAGGGAGGAAAGGAGG + Exonic
944938261 2:204592775-204592797 GTCAAGGGCTGGTGGGAATAGGG - Intronic
945100242 2:206256674-206256696 GTCAGGGGTGGGAGGGGTGAGGG + Intergenic
945406143 2:209451396-209451418 AGCAGGGCATGGAGGGAAGGGGG - Intronic
945483318 2:210366915-210366937 ATCAGGGGCTGGAGGCCAGATGG + Intergenic
945778031 2:214131790-214131812 GCCAGGGGCTGGAGGGAGGGAGG + Intronic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946165926 2:217863829-217863851 GTCTGGGGATAGAGGGAGGAAGG + Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946212758 2:218160852-218160874 GCCAGGGGATGGAGGGCAAGGGG + Intergenic
946263405 2:218516536-218516558 GTCAGGGGATGGGGGGCAAGGGG + Intronic
946390127 2:219409985-219410007 GTCAGGGAAAGGAGAGAAGCTGG + Intergenic
946445399 2:219735517-219735539 ATCAAGGGAGGGAGTGAAGAGGG - Intergenic
946954806 2:224917554-224917576 GTTAGGGGTGGGAAGGAAGAAGG + Intronic
947150763 2:227112729-227112751 GCCAGTGGCTGCAGGGAAGAGGG - Intronic
947332417 2:229044221-229044243 GTCAGGTGATGGGGGAAAGCAGG - Intronic
947439235 2:230103707-230103729 GTCAGGGGGTGGAGGGTAAGGGG - Intergenic
947792476 2:232876133-232876155 GGCGGGGGAGGGAGGGGAGAGGG + Intronic
947921165 2:233875655-233875677 GTCAGGGGGTGGGGGGAAAGGGG - Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948371775 2:237494208-237494230 GGCAGAGGGTGGAGGGCAGAGGG + Intronic
948458720 2:238119055-238119077 GGAAGAGGATGGATGGAAGAGGG + Intronic
948654338 2:239467125-239467147 GTCAGGGCGTGGGGGGAAGCTGG + Intergenic
948876356 2:240831847-240831869 GTCAGGGCCTGGAGGGGAGCTGG + Intergenic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1170431450 20:16280356-16280378 ACCAGGGGATGGAGGGAAGGAGG + Intronic
1170696019 20:18659749-18659771 GTCAGGGAGTGGGGGGAAAAGGG + Intronic
1170804990 20:19621795-19621817 GCCAGGGGTTCCAGGGAAGACGG - Intronic
1170846279 20:19964564-19964586 GTCAAGGGATCGAGGGGAGTAGG + Intronic
1170937618 20:20823697-20823719 GTCAGGGCCTGGAAGGAGGAAGG - Intergenic
1170969573 20:21104615-21104637 GTCAGGGGTTGGAGGGTGGGGGG - Intergenic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171077688 20:22145623-22145645 GTGAGGGGATGGCGTGGAGAAGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171337381 20:24396630-24396652 GTCATGGGGTGGAGGGATGGAGG - Intergenic
1171877767 20:30594272-30594294 CTCAGGCGCTGGAGGGAGGACGG - Intergenic
1172046565 20:32084572-32084594 GCCAGAGGGTGGAGGGGAGAGGG + Intronic
1172321250 20:33996789-33996811 TTCAGGGGCTGGAGGGAGGAGGG - Intronic
1172380403 20:34485644-34485666 GTAAGAAGAGGGAGGGAAGAAGG - Intronic
1172492935 20:35355702-35355724 GGCAGGGGATGAAGGTAGGAAGG - Intronic
1172544907 20:35752689-35752711 GCCAGGAGCTGGAGGGAAGGAGG + Intergenic
1172590290 20:36112934-36112956 ATCAGGGGATGGGGGAAAGTAGG + Intronic
1172611282 20:36254501-36254523 GCCAGGGCCTGGAGGGAAGAGGG + Intronic
1172898324 20:38316209-38316231 AAAAGGGGAAGGAGGGAAGAGGG - Intronic
1173053040 20:39583726-39583748 GCCAGGGGATGGGAGGGAGAGGG + Intergenic
1173265141 20:41472334-41472356 GAGAAGGGATGCAGGGAAGAGGG - Intronic
1173581462 20:44149618-44149640 AGCAGGGGTTGGGGGGAAGAGGG - Intronic
1173662731 20:44745550-44745572 GGGAGGGGAGGGAGGGAAAAAGG + Intergenic
1173707928 20:45126652-45126674 GTCTGGGGGTGGGGGGAATAGGG - Intergenic
1173727086 20:45305609-45305631 GTCAGAGCCTGGAGGGAGGAAGG + Intronic
1173817711 20:46000438-46000460 GTGCTGGGATGCAGGGAAGATGG - Intergenic
1174222826 20:48970974-48970996 GTCAGGAGAATGAGGGCAGATGG - Intronic
1174418168 20:50381148-50381170 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1174758390 20:53182264-53182286 GACGGAGGAGGGAGGGAAGAAGG - Intronic
1175110216 20:56642596-56642618 GACAGGTGATGGAGTGAAGTCGG + Intergenic
1175189748 20:57203334-57203356 GACAGGGGATGGAGGGTGAATGG + Intronic
1175427885 20:58881475-58881497 GTCTGGAGAGGGAAGGAAGAAGG - Intronic
1175719435 20:61276750-61276772 GTCAGGGGCTGTTGGGCAGAGGG + Intronic
1175730582 20:61351068-61351090 GCCCGGGGATGGAGGGAGGGCGG - Intronic
1175817230 20:61889585-61889607 GTTAGTGGATGGATGGATGATGG + Intronic
1175817396 20:61890471-61890493 GTGAGTGGATGGATGGATGATGG + Intronic
1175820086 20:61904404-61904426 GCCAGGGGAGAGACGGAAGAGGG - Intronic
1176103380 20:63374615-63374637 GGCTCGGGATGGAGGGAGGAGGG + Intronic
1176114274 20:63424296-63424318 GTCAGGGGCTGCAGGGGAGGGGG + Intronic
1176286003 21:5020129-5020151 GTCAGGGGATGCAGGCACCAAGG + Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176770803 21:13071095-13071117 GTCAGGGGTTGGAGGGGAAGAGG + Intergenic
1176889625 21:14298972-14298994 GTCAGGGGAGTGGGGGCAGAGGG - Intergenic
1177541541 21:22499470-22499492 GTCAGGGCATGGAGGAAAAGGGG + Intergenic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178594260 21:33938621-33938643 GCCAGGGGCTGTGGGGAAGAAGG - Intergenic
1179010191 21:37550740-37550762 GTCAGAGGAGGGAGGGAAAGGGG + Intergenic
1179179204 21:39030954-39030976 GTCAGGGGCTGGGGGGAGGGAGG + Intergenic
1179613630 21:42567873-42567895 GCCAGGGGAAGAAGGGAGGAGGG - Intronic
1179630412 21:42674501-42674523 GCCAGGGGCTGGAGGGAGGGAGG - Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179871178 21:44243346-44243368 GTCAGGGGATGCAGGCACCAAGG - Intergenic
1179972549 21:44844353-44844375 GTCAGGGGCTGCAGGGGAGGGGG - Intergenic
1180099687 21:45578841-45578863 GTCAGGGCAGGGAGGGACCAGGG - Intergenic
1180120965 21:45747819-45747841 CTCAGAGGAGGGAGGAAAGAAGG - Intronic
1180203406 21:46241196-46241218 GTCAGGGAGTGGAGCAAAGAGGG + Intronic
1180435703 22:15301362-15301384 GTCAGGGGTTGGAGGGGAAGAGG + Intergenic
1180517941 22:16165530-16165552 GTCAGGGGTTGGAGGGGAAGAGG + Intergenic
1180735025 22:18010028-18010050 GGGAGGGGAGGGAGGGAAGCAGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181339311 22:22165680-22165702 GTGAGGGGCAGAAGGGAAGAGGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181528441 22:23502760-23502782 GACAGGGGATGGAGGGGTGGAGG - Intergenic
1181592309 22:23893049-23893071 TTCAGGGAATGGAGAGAAGTGGG + Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181656690 22:24306811-24306833 GTCAGGCGCTGGAGAGAAGAGGG - Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182519825 22:30878967-30878989 GCCAGGGGCTGCTGGGAAGAGGG + Intronic
1182587009 22:31349489-31349511 GCCAGGGGATGAAGGGAGAAGGG - Intergenic
1183123892 22:35756063-35756085 GTCAGGGGATGGGGTCGAGAAGG + Intronic
1183130711 22:35832492-35832514 GGCAGGGGATGGAGAGAGGTTGG + Intronic
1183209726 22:36443396-36443418 GTGAAGGGAGGGAGGGAGGAAGG - Intergenic
1183370970 22:37432186-37432208 GTCAGGGCATGCAAGGATGAAGG + Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183598371 22:38825788-38825810 ACCTGGGGATGGAGGGAGGAAGG - Intronic
1183729962 22:39612845-39612867 GTGGAGGGATGGAGGGAAGGAGG - Intronic
1184205269 22:42998382-42998404 GTCAGGGCATGTTGGGGAGATGG - Intronic
1184229952 22:43153017-43153039 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1184370826 22:44081018-44081040 AACAAGGGATGGAGGGATGACGG - Intronic
1184594293 22:45504445-45504467 GTAAGGGGAGCGCGGGAAGAGGG + Intronic
1184955994 22:47886262-47886284 GCAAGGGGATGGATGGGAGAGGG + Intergenic
1184959310 22:47917706-47917728 GGAAGGAGAGGGAGGGAAGAAGG - Intergenic
1185390847 22:50561069-50561091 GACAGTGGATGGAGTGTAGAAGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949144874 3:687167-687189 GGCAGGGGAAGGAAGGAGGAAGG - Intergenic
949607349 3:5668289-5668311 GAGAGGGGAGGGTGGGAAGAGGG + Intergenic
949804556 3:7940205-7940227 GTCAGGGGCTGGAGGGCTGGGGG + Intergenic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950172860 3:10851596-10851618 AGCAGGGCCTGGAGGGAAGAAGG - Intronic
950247167 3:11431556-11431578 GCCAGGGGCTGGAAGGAGGAGGG - Intronic
950797443 3:15521462-15521484 GTCAGGGGACAGGGGGAGGAAGG - Intronic
950941669 3:16898912-16898934 GGCAGGGGTTGGAGGGTGGAGGG + Intronic
950989344 3:17415841-17415863 GTGAGGTGAGGGTGGGAAGAAGG - Intronic
951038012 3:17954968-17954990 GGCAGGGGATGGAGGGTGGGAGG - Intronic
951064239 3:18245902-18245924 GCCAGGGGATGGAGGGAGAAGGG - Intronic
951149572 3:19272582-19272604 GTCAAGTGAAGGAGAGAAGAAGG - Intronic
952038272 3:29230740-29230762 GTAAGGAGAGGGAGGGAAGGAGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952187854 3:30989760-30989782 GACAGGGGAGGGAGGGAGGGAGG - Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952449074 3:33413819-33413841 GTCAGGTGATGGTGTGAAGTGGG - Intronic
952548768 3:34451106-34451128 GTCTGGGGAGGGAGCCAAGATGG - Intergenic
952740742 3:36731798-36731820 GTGAGGGGAGGGAGAAAAGAAGG - Intronic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
952868667 3:37877261-37877283 GTCAGGGCAAGGAGGGAATGGGG - Intronic
952926134 3:38320660-38320682 GTCAGGGGATGGGAGGAAAGGGG - Intergenic
953039593 3:39243692-39243714 GTCAGAGGATGGAGGGTGGGAGG - Intergenic
953156241 3:40377100-40377122 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
953243456 3:41169635-41169657 GTCAGTGGAAGGAGGTAAGCAGG + Intergenic
953265283 3:41381002-41381024 GGCAGGGGATGCATGGAGGAAGG - Intronic
953411449 3:42692622-42692644 GCCAGGGGACTGTGGGAAGAAGG + Intergenic
953812781 3:46128989-46129011 GCCAGGGGCTGGAGGGAGGGAGG + Intergenic
954134359 3:48575300-48575322 GCCAGGAGAGTGAGGGAAGAGGG - Intronic
954448380 3:50558752-50558774 TTCAGGGACTGCAGGGAAGAGGG - Exonic
954503480 3:51044425-51044447 TTCAGAGGATGGAGGGTAGGAGG + Intronic
954730322 3:52655234-52655256 GCCAGGGGCTGGAGGGAATGGGG - Intronic
954907466 3:54075069-54075091 GTCTGGAGATGGAGGCTAGATGG - Intergenic
954954518 3:54507705-54507727 GTCTGGGAATGGAGGGAGGCTGG + Intronic
955113245 3:55971156-55971178 GCCAGGGGCTGGGGGAAAGAGGG + Intronic
955152694 3:56383857-56383879 GCCAGGGGCTGGAGGGAGAAAGG - Intronic
955369131 3:58335903-58335925 GTGAAGAGATGGAGGGAGGAAGG - Intronic
955549625 3:60070053-60070075 GTGAGGGAATGGAGGCAATAGGG - Intronic
955934870 3:64093027-64093049 GTCAGGGACTGAAGGGAGGAGGG - Intergenic
956741443 3:72279290-72279312 GTGAGGGGAGGGAGGGAGAAAGG + Intergenic
957466681 3:80602509-80602531 GACAAGGGAGGGAGGGAAGGAGG + Intergenic
957494438 3:80972873-80972895 GTCAGAGGATGGAGGGTGGGAGG + Intergenic
957740726 3:84264996-84265018 GGGAGGGGATGGAGGGAGCAAGG - Intergenic
957941901 3:87017111-87017133 ATCAGGGGGTGGAGCCAAGATGG + Intergenic
957958804 3:87224248-87224270 GTCAGGGGGTGGGGGGAAAGGGG - Intergenic
958423591 3:93955572-93955594 GTCATGGGATGGGGGGAGGGGGG + Intronic
958769803 3:98412562-98412584 GTTGTGGGATGGAGGGAAGGGGG + Intergenic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
958941894 3:100326076-100326098 GGTAAGGGCTGGAGGGAAGAGGG - Intergenic
958980060 3:100709837-100709859 GGAAGGGGCTGGAGGGAGGAGGG + Intronic
959203308 3:103275751-103275773 GTCAGGGGATGGGGGCTAAAGGG - Intergenic
959549404 3:107637869-107637891 GTAAAGGGAAGGAGGAAAGAAGG - Intronic
959755280 3:109890018-109890040 GATAGGGGGTGGAGGGTAGAAGG - Intergenic
959876215 3:111385201-111385223 GTCAGGGGGTTGGGGGAAAAGGG + Intronic
960663803 3:120090823-120090845 GTTAGCTGATGGAGGGCAGAGGG - Intronic
961080411 3:124022285-124022307 GTCAGGGGTTGGGGGGGCGAGGG - Intergenic
961088377 3:124089731-124089753 GTCAGGGCAGTGAGGGAGGATGG + Intronic
961142716 3:124568822-124568844 GCCAGGGGCTGGAGGGAATGGGG + Intronic
961175893 3:124834663-124834685 GGGAGGGGAGGGAGGAAAGAAGG + Intronic
961242293 3:125421969-125421991 ATCAGGGGAAGCAAGGAAGAAGG - Intergenic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
961449992 3:126998340-126998362 GTCACAGGATGGAGGAGAGAGGG + Intronic
961736411 3:129004515-129004537 GTGGGGGGATGGATGGATGATGG - Intronic
962366942 3:134793174-134793196 TTAAGGGGAGGGAGGGAAGCTGG + Intronic
963550087 3:146709341-146709363 GTAAGGGGAGGAAGGAAAGAAGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963733817 3:148996604-148996626 GTCAGGGGATGAAGGAGAGGAGG + Intronic
963875869 3:150473538-150473560 GTCGGGGGAGGGAGGAGAGATGG + Intergenic
964205881 3:154174506-154174528 AGCAGGGGTTGGAGGGAAGAAGG + Intronic
964232030 3:154481551-154481573 ATCAGGGGATGGAGGGTGGGAGG + Intergenic
964905377 3:161713029-161713051 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
965066097 3:163850636-163850658 GGCAGGGGGTGGAGGGGAGGAGG + Intergenic
965525997 3:169718779-169718801 GTCATGGGATGGGGGGAGGGGGG + Intergenic
965652238 3:170946824-170946846 GAGAGAGGAGGGAGGGAAGAGGG + Intergenic
966028140 3:175311615-175311637 ATAAAGGGAGGGAGGGAAGAAGG - Intronic
966049896 3:175603475-175603497 GTCAGGGCCTGGAGGGAGAAGGG - Intronic
966267360 3:178062770-178062792 GTCAGGGGGTGGGGGTACGAGGG - Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967419847 3:189260806-189260828 GTCAGCAGGTGGAGGGAGGAAGG + Intronic
967568494 3:190999701-190999723 GTGAAGGGAGGGAGGGAGGAAGG + Intergenic
967686406 3:192421666-192421688 GTCAGGGGATGGAGGGCCAGGGG + Intronic
967806521 3:193719069-193719091 ATCAGGGGTTGGAGGGAAGGAGG + Intergenic
967937015 3:194737145-194737167 GGCAGGGTGGGGAGGGAAGAGGG - Intergenic
968716708 4:2165407-2165429 GTCAGGGGCTGGTGGGAGGGAGG + Intronic
968736496 4:2299639-2299661 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
968962271 4:3751659-3751681 GTCAGGGGCTGTAGGAAAGGTGG + Intergenic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969566262 4:7980189-7980211 TTCAGGCCATGAAGGGAAGAGGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
970415976 4:15857369-15857391 GTCGGGGGAGGGAGGGAGGGAGG - Intergenic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970496702 4:16633283-16633305 GTCATGGGGTGGAGGGATGGGGG + Intronic
970575807 4:17426503-17426525 ATCAGGGGATTAAGGGAAGCTGG + Intergenic
971425011 4:26507485-26507507 GTGAATGGATGGATGGAAGAAGG + Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
971658283 4:29378614-29378636 GTCAGGGGGTGGTGGGGAAAGGG + Intergenic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
971709690 4:30094414-30094436 GAAAGTGGAGGGAGGGAAGAAGG + Intergenic
971721501 4:30251043-30251065 GTCAGGGAATGGGGGGCAAATGG - Intergenic
972182097 4:36479768-36479790 GCCAGGGGCTGGAGAGAAGGAGG - Intergenic
972470293 4:39397310-39397332 GCCAGGGGCTGGAGGGAGGAGGG - Intergenic
972618894 4:40726776-40726798 GCCAGGGGATGGTAGGAAGGAGG - Intergenic
972887711 4:43512860-43512882 GTCAGGGGTTGGAGGGCAAGGGG - Intergenic
972916450 4:43886488-43886510 GCCGGGGGTTGAAGGGAAGAAGG - Intergenic
973730282 4:53816354-53816376 CACAGGGGATTGAGGCAAGAGGG - Intronic
973737704 4:53888798-53888820 GCCAGGGGATGGAGGGCAGAGGG + Intronic
974077400 4:57179968-57179990 GTCATGGGGTGGGGGGAAGGGGG - Intergenic
974281588 4:59801930-59801952 GTTGGGGGATGGAGAGAAGCAGG + Intergenic
974425939 4:61743718-61743740 GACAGGGGCTGGAGCCAAGATGG + Intronic
974735545 4:65927092-65927114 GTCATGGGATGAGGGGAAGCAGG - Intergenic
974825051 4:67117447-67117469 GTCAGGGGGTGGAGGGAAAAGGG + Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975069587 4:70117830-70117852 GTCATGGGGTGGAGGGAAGGGGG - Intergenic
975098875 4:70489423-70489445 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
975644415 4:76532052-76532074 GTCATGGGATGGGGGGAGGGGGG - Intronic
975924269 4:79430191-79430213 GTCGAGGGCTGGAGGAAAGATGG - Intergenic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976074262 4:81278889-81278911 GTCAGGGGGTGGGGGGCAAAGGG - Intergenic
976220551 4:82753732-82753754 GTCAGGGGAAAAGGGGAAGATGG - Intronic
976700819 4:87966804-87966826 GGCAGAGGATGGAGAGATGAAGG + Intergenic
977115743 4:93025105-93025127 GAAAGAGGAGGGAGGGAAGAAGG + Intronic
977204032 4:94149685-94149707 GTCAGGGGATGGGGGGCAAGGGG - Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978815888 4:112905017-112905039 TCAAGGGGAAGGAGGGAAGAAGG + Intronic
979037825 4:115747821-115747843 GTCATGGGATGGGGGGATGGGGG + Intergenic
979319318 4:119303867-119303889 GTTAGAGCATGGAGGGAACATGG - Intronic
980096609 4:128497860-128497882 GTAGGGGGAAGTAGGGAAGAGGG - Intergenic
980519715 4:133916162-133916184 GTCAGGGGGTGGAGGGTAAGGGG - Intergenic
980538901 4:134166830-134166852 GTCAGTGAATGAAGGGCAGAGGG - Intergenic
980984767 4:139684682-139684704 TTCAGGGGTTGAAGGAAAGAGGG + Intronic
980991971 4:139745858-139745880 TCCTGGGGATGGAGGAAAGATGG + Intronic
981117928 4:141013972-141013994 CTCAGGGGAGGGAGGGAATGGGG - Intronic
981126846 4:141116987-141117009 GTCAGGGGGTGGGGGGACTAGGG + Intronic
981169843 4:141609032-141609054 GGAAAAGGATGGAGGGAAGAAGG + Intergenic
981243737 4:142509372-142509394 GTCAGGGGATGGGGGGCAAGGGG - Intronic
981307482 4:143262261-143262283 GGTAGGGGCTGGAGAGAAGATGG + Intergenic
981864877 4:149405405-149405427 GTCAGGGGATGGGGGGCTGGGGG + Intergenic
981949185 4:150385590-150385612 GACAGAGGAAGAAGGGAAGAGGG + Intronic
982047927 4:151467825-151467847 GTCAGGGGGTGGAGGGCAAGGGG + Intronic
982233908 4:153234303-153234325 TTCAGGGGTGGGAGGAAAGAAGG + Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982410352 4:155069082-155069104 GTCATGGGGTGGAGAGAAGAGGG + Intergenic
982523474 4:156449630-156449652 GTCAGGGGATGGAGGGCTAGGGG - Intergenic
982882207 4:160734005-160734027 GTCAGAGAATGGAGGGTGGAAGG - Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983257014 4:165411322-165411344 GAAGAGGGATGGAGGGAAGAAGG - Intronic
983457361 4:167982167-167982189 GTCAGGGGGTGGGGGGAGGGGGG - Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983537101 4:168869469-168869491 GACAGTGGATGGAGAGAAGTTGG + Intronic
983725039 4:170910839-170910861 GTCAGGGGATGGGGGGGCTAAGG - Intergenic
983831963 4:172338951-172338973 GTCCAGGCATGGAGGGGAGAGGG + Intronic
984851994 4:184162530-184162552 GGAAAGGGAGGGAGGGAAGAAGG + Intronic
985100990 4:186458486-186458508 GTGGGGGGAGGGAGGGACGAGGG - Intronic
985151864 4:186955401-186955423 GTTAGGGGTGGGAGTGAAGATGG - Intergenic
985283790 4:188313466-188313488 GTCAGGCGGTGGAGGGAAAAGGG - Intergenic
985487124 5:158185-158207 GGCAGGGGGAGGAGGGGAGATGG - Intronic
985625962 5:987830-987852 GGGAGGGGAAGGAGGGAAGGAGG + Intergenic
985627661 5:998228-998250 GACGGGGGAGGGAGGGAAGAGGG + Intergenic
986412150 5:7492017-7492039 GTCACGGGGTGGAGGGCACATGG + Intronic
986530102 5:8726995-8727017 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986726228 5:10599492-10599514 ATCAGGGGCTGAGGGGAAGAGGG - Intronic
987026209 5:13929321-13929343 GCCAGGGGCTGGAGGGAAGGAGG + Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987502205 5:18727469-18727491 TTCAGAGGATGGAGGGTGGAAGG - Intergenic
987533357 5:19150228-19150250 GTCATGGGGTGGAGGGATGGGGG - Intergenic
987723418 5:21666403-21666425 GTCAGGGGATAGGAGGAGGAGGG + Intergenic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
989064676 5:37447783-37447805 GTCATGGGATGCGGGGAGGAGGG + Intronic
989242259 5:39215012-39215034 GCCAGGGGCTGGAGGGAGGAGGG + Intronic
989397217 5:40970753-40970775 GTCAGGGGATGGGGGGCAAGGGG - Intronic
989605688 5:43242371-43242393 GGCAGGAGATGGAGGGGAGCAGG + Intronic
989672213 5:43932068-43932090 GTCAGGGGGTGGGGGGAGGTAGG - Intergenic
989679211 5:44009282-44009304 CTCAGGGGAAGTAGGGGAGAGGG - Intergenic
989813271 5:45704317-45704339 GTCAGGGGGTGGGGGGAAGGGGG - Intergenic
989829685 5:45900111-45900133 GTTAGGGAATGGATGGATGATGG - Intergenic
990239107 5:53799075-53799097 GTAATGGGCTGAAGGGAAGAGGG + Intergenic
990359390 5:55002925-55002947 GTCATGGGATGTGGGGAAGGGGG + Intronic
990561747 5:56990506-56990528 GTGAGAGGAAGGAGGAAAGAAGG - Intergenic
990589695 5:57249855-57249877 GAAAGGGGAAGGAGGGAAGGGGG - Intronic
990589705 5:57249877-57249899 GAAAGGGGAAGGAGGGAAGGGGG - Intronic
990589715 5:57249899-57249921 GAAAGGGGAAGGAGGGAAGGGGG - Intronic
990589725 5:57249921-57249943 GAAAGGGGAAGGAGGGAAGGGGG - Intronic
990623751 5:57588691-57588713 GTCATGGGATGGGGGGAAGGGGG + Intergenic
990758715 5:59104690-59104712 GGAAGGGGAGGGAGGAAAGAAGG + Intronic
990872023 5:60442436-60442458 GTCAGGGGGTGGGGGGACTAGGG + Intronic
991350179 5:65713254-65713276 GTGAGGGGGAGGAAGGAAGAAGG - Intronic
992135115 5:73736840-73736862 GTGAGGGGAGGGAGGGAGGGAGG + Intronic
992183934 5:74225738-74225760 GGAAGGGGAGGGAGGGAAGAAGG - Intergenic
992329599 5:75702158-75702180 GTCAGGGGGTGGAGGGTAAGGGG + Intronic
992508418 5:77410042-77410064 AGCAGGGGAGGGAGGGAACATGG - Intronic
992614320 5:78534612-78534634 GACATGGGAAGGAGGGAAGATGG - Intronic
992809357 5:80371387-80371409 ATCAAGGGATGGAAGAAAGATGG - Intergenic
992884285 5:81142427-81142449 GTCAGAGGATGATGGGAAGCAGG + Intronic
993255859 5:85589013-85589035 GGCAGGAAAGGGAGGGAAGATGG + Intergenic
993888849 5:93448045-93448067 GTCGTGGGGTGGAGGGAAGGGGG + Intergenic
994448330 5:99906653-99906675 GTTAGTTGATGGAGGGAAAAAGG - Intergenic
994479206 5:100311471-100311493 GTCAGGGGGTGGGGGGAATAGGG + Intergenic
995178601 5:109208649-109208671 GTCATGGGATGGGGGGAGGGGGG - Intergenic
995336792 5:111008797-111008819 GTCGGGGGATGGGGGGACTAGGG - Intergenic
995565061 5:113425860-113425882 GGAAGTGGATGGAGGGAAGATGG + Intronic
995601768 5:113805157-113805179 GCCAGCAGATGGAGGTAAGATGG + Intergenic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
996088246 5:119325806-119325828 TTCAGGGGAAGGAGGGGACAGGG - Intronic
996140829 5:119906606-119906628 TTCTGGGGATGGAGCCAAGATGG - Intergenic
996319661 5:122200677-122200699 GTCAGGGGTTGCAGGGGTGAAGG - Intergenic
996363368 5:122675039-122675061 GCCAGGGGCTGGAGGGAAAGGGG - Intergenic
996621298 5:125506935-125506957 GTCTGGGGGTGGAGGGAAAGGGG - Intergenic
996660707 5:125998944-125998966 GTCAGGGGATGGGGGGCAAGGGG + Intergenic
996858958 5:128042926-128042948 GCCAGGGCAGGGAGGAAAGAAGG + Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997082603 5:130758295-130758317 GTCAGGGGATGGAGGGATAGGGG + Intergenic
997097498 5:130929531-130929553 GTCAGGGGGTGGGGGGTAGGGGG + Intergenic
997418848 5:133750439-133750461 GTGATGGGAGGGAGGGAAGCTGG - Intergenic
997622481 5:135307841-135307863 GGCAGTGGAGGGAGGGAAGGAGG - Intronic
997833070 5:137169193-137169215 GTGAGGGGTTGGGGGGAAGTGGG + Intronic
997849393 5:137317314-137317336 GCCAGGAGATGGAAGGAACAAGG - Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999037996 5:148375054-148375076 AGCAGGGGATAGGGGGAAGAGGG + Intergenic
999064835 5:148674326-148674348 GTCTGGGGGTGGAGCCAAGATGG - Intronic
999318071 5:150596823-150596845 GTCAGGGCAAGGAGGCTAGAAGG + Intergenic
999417797 5:151415009-151415031 GTCAAGGTATGGAGTCAAGAGGG + Intergenic
999453902 5:151699000-151699022 TTCAGGGGAGGGAGAGAAGCAGG - Intergenic
999584960 5:153080176-153080198 GTCAGGGGGTGGAGGGCTGCGGG - Intergenic
999591141 5:153148055-153148077 GCCAGGGCATGGAGCAAAGAGGG - Intergenic
999620803 5:153471273-153471295 GTTGGGGGGTGGAGGGCAGAAGG - Intergenic
999812065 5:155137179-155137201 GTCAGAGGGTGGAGGGTGGAAGG - Intergenic
999939204 5:156522189-156522211 GTCAGGGGGTGGGGGGCTGAGGG + Intronic
999946362 5:156600305-156600327 GGGAGGGGATGGAGGAGAGAAGG - Intronic
1000332892 5:160219765-160219787 GCCAGGGGATGTGGGCAAGAAGG - Intronic
1000467476 5:161597534-161597556 GTCACGGGATGGGGGGAGGGGGG + Intronic
1000573772 5:162949976-162949998 GGGAGGGGAAGGAGTGAAGAGGG + Intergenic
1000746359 5:165039198-165039220 GTCATGGGGTGGGGGGAGGAGGG - Intergenic
1000828568 5:166075771-166075793 GAAAGGGGGAGGAGGGAAGAAGG + Intergenic
1000903728 5:166937717-166937739 GAGAGGGGAAGGAGGAAAGAAGG + Intergenic
1001180674 5:169517162-169517184 GTCAGGGGGTGGGGGGATGGGGG - Intergenic
1001468477 5:171990123-171990145 GAAATGGGAAGGAGGGAAGAAGG + Intronic
1001635041 5:173203793-173203815 TCCAGGGGCTGGAGGGAGGAGGG - Intergenic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001777781 5:174341864-174341886 GACAGGGAATTGAGGGATGATGG + Intergenic
1001854120 5:174995870-174995892 GTCACAGGAGGGAGGGAGGATGG + Intergenic
1001919376 5:175588522-175588544 GGGAGGAGAGGGAGGGAAGAAGG + Intergenic
1001922858 5:175614039-175614061 GGCTGAGGATGGAGGGAAAATGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002084536 5:176764447-176764469 GCCAGGGGTTGGGGGGAAGGAGG - Intergenic
1002102360 5:176863791-176863813 AGGAGGGGAAGGAGGGAAGAAGG - Intronic
1002209404 5:177587715-177587737 GGAAAGGGATGGAGGGAATAAGG + Intergenic
1002255635 5:177956534-177956556 GCCAGGGGCTGGAGGGAGGAGGG + Intergenic
1002347163 5:178556032-178556054 GTGCTGTGATGGAGGGAAGAAGG - Intronic
1002383019 5:178843922-178843944 GTCAGGTGGTGGAGGGATGCTGG - Intergenic
1002421349 5:179150751-179150773 GCCAGGGGATGGGGCGAGGAGGG + Intronic
1002551083 5:179992869-179992891 GTCATGGGTTGGGGGGAAGAGGG - Intronic
1002634469 5:180600279-180600301 GACAGGCGAGGGAGGGAAGTGGG - Intergenic
1002984277 6:2173442-2173464 TACAGGGCATGGAGGGAAGGAGG + Intronic
1003071434 6:2948250-2948272 GTCAGGGGACAGAGAGGAGAGGG + Exonic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003472056 6:6445947-6445969 GTCAAGGGGTGGGGGGAAAAGGG - Intergenic
1003552962 6:7115217-7115239 GTAAGGGGATGCAGGGTAGGAGG + Intronic
1003583760 6:7367152-7367174 GAAGGGGGATGGAGGGAAGAGGG - Intronic
1003586188 6:7391038-7391060 GTCTGGGGAAAGAGGGATGAAGG + Intronic
1003593022 6:7451649-7451671 GCCAGGGACTAGAGGGAAGAGGG + Intergenic
1003731755 6:8832406-8832428 GTCAGGGATTGGAGGAAAGAAGG - Intergenic
1003872204 6:10412419-10412441 GAGAGGGGAGGGAGGGAAGGAGG + Intronic
1003996717 6:11548920-11548942 GTCATGGGGTGGGGGGAAGGGGG + Intronic
1004234776 6:13864839-13864861 GTCAGGGGGTGGAGGGCAAGGGG - Intergenic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004751332 6:18565600-18565622 GGAAAGGGATAGAGGGAAGAAGG - Intergenic
1004829488 6:19462151-19462173 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1004882266 6:20020725-20020747 GCCAGGAGCTGGAGGGAAGTGGG + Intergenic
1005005717 6:21285555-21285577 GGCTGGGGATGGAAGGAAGCAGG - Intergenic
1005022636 6:21432450-21432472 GGCAGGGGAAGAGGGGAAGAGGG + Intergenic
1005473466 6:26184643-26184665 GTGAGGCGGTAGAGGGAAGAGGG - Intergenic
1005825639 6:29630299-29630321 GGCAGGTGATGGAGGAAAAAGGG + Intronic
1005997990 6:30943087-30943109 GCCAGGGCAGGAAGGGAAGAGGG + Intronic
1006077081 6:31540542-31540564 GGCAGGGGAAGAAGGGAAGGGGG + Exonic
1006112908 6:31759566-31759588 GCCAGGGGAAGGAGGGGAGTGGG + Intronic
1006388358 6:33744857-33744879 GTCAGGGGCTGAAGGGGAGGGGG + Intronic
1006648859 6:35534774-35534796 GGCAGGGGAGGGAGGGAGGGAGG - Intergenic
1006806595 6:36793230-36793252 GGCAGGGGAGGAAGGGAAGCCGG + Intronic
1007044262 6:38756665-38756687 GTCATGGGGTGGAGGGAGGGGGG - Intronic
1007219721 6:40268984-40269006 GCCAGGGGATAGAGGGTGGAGGG + Intergenic
1007260453 6:40559542-40559564 GGCAGCGGAGGGAGGGAAGAGGG + Intronic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007408631 6:41648960-41648982 GGGAGAGGAGGGAGGGAAGAAGG - Intronic
1007624173 6:43233615-43233637 GTGATGGGATGGAGGAATGAGGG + Intergenic
1007959693 6:45947471-45947493 GGCAGTGGATGGAGGGGTGAGGG - Intronic
1008207915 6:48685926-48685948 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1008227436 6:48937259-48937281 GCCAGGGGATGGAGTAAGGATGG + Intergenic
1008286751 6:49662312-49662334 GCCAGGAGTTGGAGGGAAGGAGG + Intergenic
1008333769 6:50275082-50275104 GTCATGGGGTGGAGGGAAGGGGG - Intergenic
1008631728 6:53368340-53368362 ACCAGGGGCTGGAGGGAGGAGGG + Intergenic
1008954025 6:57194947-57194969 GGCAGGGAAGGGAGGGAAGGTGG + Intronic
1008957668 6:57233650-57233672 GTCAAGGGAGGGAGGGAGGGAGG - Intergenic
1009330109 6:62408699-62408721 TTCAGAGGATGGAGGGGAGGAGG + Intergenic
1009369903 6:62886135-62886157 GAAAAGGGAGGGAGGGAAGAAGG + Intergenic
1009688701 6:66997931-66997953 GTCAGGGGGTGGAGGGCTGGGGG + Intergenic
1009694965 6:67090510-67090532 GACAGGGGTTGGAGGAAAGAAGG - Intergenic
1009742697 6:67767766-67767788 GTCAGGGGATGGGGGGATAGGGG + Intergenic
1009892028 6:69696494-69696516 TTTAGGGGTTGGAGGGAGGAAGG - Intronic
1009910759 6:69924247-69924269 GTCATGGGGTGGGGGGAAGGGGG - Intronic
1010178569 6:73057324-73057346 GTCATGGGGTGGGGGGAAGGGGG + Intronic
1010312801 6:74407137-74407159 GTCATGGGGTGGGGGGAGGAGGG + Intergenic
1010344036 6:74790468-74790490 GTCAGGGGAGGGGGGAAGGATGG + Intergenic
1010379564 6:75208870-75208892 GAAAGGGGAAGGATGGAAGAGGG - Intergenic
1010632213 6:78211412-78211434 GCCAAGGGCTGGAGGGGAGAGGG - Intergenic
1010828268 6:80498902-80498924 GTCAGGGAAGGGAGGGAACTGGG - Intergenic
1010855483 6:80833261-80833283 GTCTGAGGATGGACTGAAGAAGG - Intergenic
1011567738 6:88695994-88696016 GTTAGGGGATGGGGGAAACAGGG + Intronic
1011675717 6:89731605-89731627 GTCAGGGGATGGGGGGCAAGGGG + Intronic
1011723512 6:90184467-90184489 GTGAAGGGGTGGAGGGAGGAAGG - Intronic
1012288531 6:97422621-97422643 GCCAGGGGATGGAGGACGGATGG + Intergenic
1012814006 6:103999094-103999116 ATCAGAGGGTGGAGGGCAGAAGG - Intergenic
1012832287 6:104219309-104219331 GTCAGGGGGTGGAGGGCTGAGGG + Intergenic
1012904255 6:105046161-105046183 GTCATGGGGTGGAGGGAGGGGGG - Intronic
1012945748 6:105463845-105463867 GTGGGGGGATGGGGGGGAGAGGG - Intergenic
1013252292 6:108346329-108346351 GCCAGGGGCTGGAGGGAGGAAGG - Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1013718694 6:112995738-112995760 GTCAGGGACTGGAGGGAGGAAGG - Intergenic
1013747858 6:113367017-113367039 GTAAGTGCAAGGAGGGAAGAAGG - Intergenic
1013964759 6:115941339-115941361 GTCAGGGGATGGAGGGCTAGGGG + Exonic
1013981205 6:116131820-116131842 TTCAGAGGGTGGAGGGTAGAAGG - Intronic
1014017602 6:116551123-116551145 GTCAGGGGACAGAAGGAAGCAGG - Intronic
1014129621 6:117816039-117816061 GTCATGGGGTGGAGGGAGGGGGG - Intergenic
1014518644 6:122410573-122410595 GTCAGGGGCTGCGGGGAGGAAGG - Intronic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1014786710 6:125627727-125627749 GACAGGGGTTGTAGGGGAGATGG + Intergenic
1014877977 6:126684737-126684759 GAAGGGGGAGGGAGGGAAGAGGG + Intergenic
1015054268 6:128881132-128881154 GGAAGGGGATAGAGGGAACATGG + Intergenic
1015093327 6:129385141-129385163 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1015211992 6:130708919-130708941 GCCAGAGGGTGGAGGGAAGAGGG + Intergenic
1015318249 6:131842010-131842032 GGAAGGGGCTGGAGGGAAAAGGG - Intronic
1015517579 6:134099321-134099343 GTAATGGGATGGAGTGAGGAAGG - Intergenic
1015570833 6:134619708-134619730 GTGAGGAGATGCAGGGAGGATGG + Intergenic
1015645203 6:135379916-135379938 GTTGGGGGAGGGAGGGAGGAAGG - Intronic
1015823208 6:137284445-137284467 GGCTGGGAAAGGAGGGAAGATGG + Intergenic
1015975077 6:138782075-138782097 CTCAAGGGTAGGAGGGAAGAAGG - Intronic
1016054858 6:139567585-139567607 GCCAGGGGATGGAGGAAGGGTGG + Intergenic
1016339650 6:143049391-143049413 GGCAGAGGATGGAGAGAGGATGG - Intergenic
1016368980 6:143351735-143351757 GTCAGAGGGTGGAGGGAAAGGGG - Intergenic
1016456868 6:144240061-144240083 GTGAAGGGATGGGGGGAAAATGG - Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1016706914 6:147119470-147119492 GCCAGGGGCTGGAGGGAAGAGGG + Intergenic
1016762495 6:147753689-147753711 GTGAGGGGCTGGGGGGAAGGTGG - Intergenic
1016772823 6:147870821-147870843 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1016791517 6:148071278-148071300 GTCAGGAGATGTGGGGATGAGGG - Intergenic
1016888145 6:148978668-148978690 GTCAGGGGTTGGGGGGAAAGGGG + Intronic
1017065754 6:150527757-150527779 GTCGGGGGCTGGAGGGAGGCTGG - Intergenic
1017082633 6:150683869-150683891 GGCCTGGGATGGAGGTAAGATGG + Intronic
1017282023 6:152636222-152636244 GTCAGGGGGTGGAGGAAGGGAGG + Intronic
1017807394 6:157957544-157957566 GTCAGGAGATGGAGACAAGATGG - Intergenic
1018040373 6:159916327-159916349 GCCGGGGGCTGGAGGGAGGAGGG + Exonic
1018135570 6:160775408-160775430 GGCAGGGGATGAAGTGAACAAGG + Intergenic
1018265917 6:162024170-162024192 GTTGGGGGAGGGAGGGAGGAAGG - Intronic
1018438153 6:163782095-163782117 TTCAGGGGATGGTGTAAAGAAGG + Intergenic
1018552697 6:165016585-165016607 GTCATGGGGTGGAGGGAGGCGGG - Intergenic
1018683607 6:166284629-166284651 GTCAGGGCGTGGATTGAAGATGG - Intergenic
1018857239 6:167683475-167683497 CACAGGGGATGGAGGGATGGGGG + Intergenic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019374477 7:682033-682055 GTAAGGGGAGGGAGGGAGGAAGG + Intronic
1019781398 7:2942334-2942356 GGAAGGGGAGGGAGGGAGGAAGG - Intronic
1019806465 7:3129933-3129955 GTGAGGGGAAGGAGGGAGGGAGG + Intergenic
1019912436 7:4108832-4108854 GCCAGGGGATGGGGAGAGGAGGG - Intronic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020510743 7:9054011-9054033 GTCATGGGGTGGCGGGAAGTGGG - Intergenic
1020650959 7:10875675-10875697 GTCAGGGGCTGGGGGAAAGGTGG - Intergenic
1020693284 7:11385863-11385885 GTGAGGGGGTGGAGGTAAGGGGG - Intronic
1020885703 7:13816848-13816870 ATCAGGGGAAGGAGAGAAGAGGG - Intergenic
1021056764 7:16058717-16058739 GTTAGGAGATGGAGGAAAGAGGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021360023 7:19701369-19701391 TACAGGGAACGGAGGGAAGAAGG + Intronic
1021414176 7:20362866-20362888 GTTAGTGGATGGAGGGATAAAGG + Intronic
1021540906 7:21757037-21757059 GCCATTGGATGGAGGGAAGGAGG + Intronic
1021542100 7:21771198-21771220 TTCAAGGGAGGGAGGGAGGAAGG - Intronic
1021603292 7:22386046-22386068 ATCAGGGGCTTGGGGGAAGAGGG - Intergenic
1021644159 7:22771435-22771457 GCCAGGGGATGGGGAGAAAAGGG + Intergenic
1021753545 7:23828724-23828746 GTCAGGGGGTGGAGCCAAGATGG - Intronic
1021771690 7:24009113-24009135 GTCAGGGGATGGGGGGTGGGGGG - Intergenic
1021848712 7:24787257-24787279 CACAGGGGAAGGAGGGAACATGG + Intergenic
1022283202 7:28931120-28931142 GTCGGGGGATAGGGGGATGAAGG - Intergenic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022509463 7:30925938-30925960 GTGAGTGGAGGGAGGGAGGAAGG - Intergenic
1022661417 7:32370633-32370655 GTCATGGGGTGGGGGGAAGGGGG + Intergenic
1022869896 7:34465882-34465904 GTCAGAGGTGGGAGTGAAGAGGG - Intergenic
1023014892 7:35956975-35956997 GTCAGGGGGTGGAGGGCTGGGGG - Intergenic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1023492611 7:40760424-40760446 GTCAGGGGCTGGAGGGAGAGGGG + Intronic
1023589868 7:41770338-41770360 GTCAGAGGATGGGGGGAAAGGGG + Intergenic
1024044307 7:45576445-45576467 GGCAGGGGCGGGAGGGAAGAAGG + Intronic
1024053182 7:45642377-45642399 GTCAGGGGATGGACTGGGGATGG + Intronic
1024349495 7:48349334-48349356 TTGAGGGGATGAAGGGCAGAAGG + Intronic
1024516972 7:50267501-50267523 GGCAGGTGAGAGAGGGAAGAGGG - Intergenic
1024518865 7:50285154-50285176 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1024614853 7:51102890-51102912 GCCAGGCGATGAGGGGAAGAGGG + Intronic
1024682469 7:51707396-51707418 GTCAGGGGCTGGAGGGAAAGGGG - Intergenic
1024717514 7:52096750-52096772 GTCAGGGATTAGAGGGAGGAAGG + Intergenic
1025871763 7:65440943-65440965 GTCTGGGGATGGAAGAAATAGGG - Intergenic
1025888584 7:65623031-65623053 GTCAGGGGGTTGAGGGCAAAAGG + Intergenic
1026062255 7:67036918-67036940 GGCAGGGACTGGAGGGAGGAGGG + Intronic
1026369059 7:69680606-69680628 ACCAGGGGCTGGAGGGAACAAGG - Intronic
1026421892 7:70247348-70247370 GTCAGAGGCTGGTGGGAAGAGGG + Intronic
1026630707 7:72035279-72035301 ATCAGGGGCTGGAGGGTAGGGGG - Intronic
1026827948 7:73595778-73595800 GTCAGGGGCTGGGGGTAAGGCGG + Intronic
1026951455 7:74349988-74350010 GTCAGGGGCTGTCAGGAAGATGG + Intronic
1027230192 7:76267879-76267901 GCCAGGGCTTGGTGGGAAGAGGG - Intronic
1027345798 7:77258227-77258249 GCCAGGGGGTGGAGGGAGGAGGG - Intronic
1027456869 7:78403145-78403167 GTCATGGGATGGGGGGAGGGAGG - Intronic
1027519671 7:79189782-79189804 GTCAGGGGTGGGAGGGAAGAAGG - Intronic
1027646674 7:80809942-80809964 ATCAGGGGCTGGAGGACAGAGGG + Intronic
1028050604 7:86179948-86179970 GTCATGGGGTGGGGGGAGGAGGG + Intergenic
1028355583 7:89902381-89902403 GGCAGGGGAAGGAGCCAAGATGG - Intergenic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1028739980 7:94262944-94262966 GTCAGAGGATAGAGAGAACATGG - Intergenic
1029062836 7:97816329-97816351 GTCATGGGATGGAGGGATGGGGG + Intergenic
1029146124 7:98447381-98447403 GTGGGAGGATGCAGGGAAGAGGG + Intergenic
1029148765 7:98465498-98465520 GCAAAGGGATGGAGAGAAGAGGG - Intergenic
1029412912 7:100427018-100427040 GAAAGGGGAGGGAGGGAGGAGGG - Intronic
1029423107 7:100481671-100481693 GTCTGGGGAAGGAGGGACCAAGG - Intergenic
1030056221 7:105586034-105586056 GACAGGGGAGGGTGGGAGGAGGG + Intronic
1030162892 7:106526590-106526612 GTCATGGGGTGGGGGGAAGGGGG - Intergenic
1030234849 7:107247218-107247240 GACAGGGGAGGGTGGGAGGAGGG + Intronic
1030237958 7:107287638-107287660 GCCTGGGGATGGAGTGAGGAAGG - Intronic
1030910848 7:115247098-115247120 GTCAGAGGGTGGAGGGAAAGAGG - Intergenic
1030912962 7:115275855-115275877 GTCAGGGGGTGGAGGGATAGGGG - Intergenic
1031052804 7:116961930-116961952 GTCAGGGGGTGGGGGGGTGAGGG - Intronic
1031278918 7:119770056-119770078 GCTAGGGGATGGAGGGAATGGGG + Intergenic
1031484741 7:122312837-122312859 GTCGGGGGAGGGGGGGAAGGGGG - Intergenic
1031995778 7:128229910-128229932 GGCAGGGGAGGGAAGGAGGAAGG + Intergenic
1032068639 7:128790993-128791015 GGCGGGGGAGGGAGGGAAGGAGG + Intronic
1032372675 7:131374458-131374480 GCAAGGGGACGGAGGGCAGAAGG - Intronic
1033065516 7:138150114-138150136 GCCAAGGACTGGAGGGAAGAAGG + Intergenic
1033400611 7:141020306-141020328 GCCAGGGGGTGGAGGGAGGGAGG + Intergenic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033517123 7:142118169-142118191 GTCAGGAGTTAGGGGGAAGAGGG - Intronic
1033586816 7:142780388-142780410 CTCAGGAGATGCAGGGAGGAAGG - Intergenic
1033829303 7:145233250-145233272 GTCAGGGGATGGGGGGCTAAGGG - Intergenic
1033954174 7:146824031-146824053 GTCAGGGGTTGGAGGGCTGGGGG - Intronic
1034026732 7:147712740-147712762 GTCATGGGGTGGTGGGAGGAGGG + Intronic
1034416220 7:150965587-150965609 GGGAGGAGTTGGAGGGAAGAGGG - Intronic
1034419862 7:150984310-150984332 GTCAGAGGAGTGAGGGAGGAAGG - Intergenic
1034427931 7:151024256-151024278 GGCAGGGGACAGAGAGAAGATGG + Exonic
1034738278 7:153449272-153449294 GACAAGGGCTGGAGGGAAGCAGG + Intergenic
1035044500 7:155954785-155954807 GTCAGGAGGTGGAGGGCAGGAGG - Intergenic
1035231653 7:157469338-157469360 GTCAGGGGATGGTAGGAACCTGG - Intergenic
1035249392 7:157587072-157587094 GGCAGGGGTGGGTGGGAAGATGG - Intronic
1035437739 7:158871657-158871679 GAAAGGGGAAGGAGGGAAGCGGG - Intronic
1035663401 8:1363679-1363701 GTCAGGACATGGAGAGAAGCTGG + Intergenic
1035673707 8:1439701-1439723 CCTAGGGGATGGCGGGAAGAAGG - Intergenic
1035862922 8:3049566-3049588 GTCAGGGGTTGGATGCAGGAAGG + Intronic
1036130647 8:6106476-6106498 ATGAGGGGATGGAAGAAAGAAGG - Intergenic
1036149744 8:6286362-6286384 ATCAGTAGATGGAGTGAAGAAGG - Intergenic
1036207491 8:6815768-6815790 GGGAGGGGATGCAGAGAAGAAGG + Intronic
1036544816 8:9757482-9757504 GTCAGGGGAAGGAGGGAAGTGGG - Intronic
1036837174 8:12082254-12082276 GTCAGGGGATGGGGGCGCGAGGG + Intergenic
1037060497 8:14503292-14503314 GTCAGGGGATGGGGGGCAAGGGG + Intronic
1037200342 8:16244833-16244855 GTAAGGGGTTGGAAGGAAAAGGG - Intronic
1037305544 8:17499394-17499416 GAGAGAGAATGGAGGGAAGAGGG - Intronic
1037480613 8:19302036-19302058 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1037673784 8:21037399-21037421 GGCAGGGAAAGGAGAGAAGAGGG + Intergenic
1037909921 8:22738248-22738270 TTCAAGGGATGGAGGGAAAGAGG - Intronic
1038152674 8:24956571-24956593 GACAGGGGAGAGAGGGAAGGGGG + Exonic
1038183938 8:25255511-25255533 GCCAGGGGTTAGAGGGAAGGAGG + Intronic
1038360577 8:26871818-26871840 GTCAGGGGATGGGGGGCAAGGGG - Intergenic
1038694058 8:29789888-29789910 ACCAGGGGCTGGAGGGAGGAAGG + Intergenic
1038727416 8:30094215-30094237 GACTGGGGATGGAGGGATGGAGG + Intergenic
1038929530 8:32177538-32177560 GTCAAGGGATGGGGGGAAAAGGG - Intronic
1039218102 8:35296291-35296313 GTCAAAGGATGGAGAGAAAAGGG - Intronic
1039382581 8:37099931-37099953 GGCAGGGACGGGAGGGAAGAGGG - Intergenic
1039569181 8:38573460-38573482 GGCAGGGGATGGAGGTGAAAGGG + Intergenic
1039674155 8:39641484-39641506 ATCAGAGGATGGAGGGTAGGAGG - Intronic
1039712392 8:40068880-40068902 GTCAGGGGGTGGGGGGCAGGGGG + Intergenic
1039721501 8:40169312-40169334 GTCAGGGGAAAGTGGGAGGAGGG + Intergenic
1040369818 8:46758237-46758259 GCCAGGGGGTGGAGCCAAGATGG - Intergenic
1040392755 8:46963614-46963636 GTCAGGGGTTGAAAGGAAAAGGG + Intergenic
1040445972 8:47494003-47494025 GTGAGGGGAAGGAGAAAAGAAGG - Intronic
1040557242 8:48491519-48491541 GTCAGGGGTTGGGGGGCAGGGGG + Intergenic
1040702080 8:50078367-50078389 GTCATGGAATGCCGGGAAGAAGG - Intronic
1040860080 8:51990105-51990127 GTCAGTGGGTGGAGGGAGAAGGG - Intergenic
1041073039 8:54143762-54143784 GTAAGGGAATGGAGGGAGCAGGG - Intronic
1041665312 8:60438772-60438794 GTCATGGGGTGGAGGGATGGGGG - Intergenic
1041779405 8:61561033-61561055 GTAAGGGAAGGAAGGGAAGAAGG + Intronic
1042013326 8:64275914-64275936 TTCAGAGGAAGGAAGGAAGAAGG + Intergenic
1042102717 8:65291197-65291219 GTCAGGCAAAGGAAGGAAGAGGG - Intergenic
1042191268 8:66189890-66189912 GGCAGGGGCTGAAGGGAGGAAGG - Intergenic
1042323506 8:67503898-67503920 GTCAGGGGATGGGGGAAAATGGG - Intronic
1042329546 8:67563864-67563886 GTCATGGGAGTGAGGGAAGGTGG - Intronic
1042818532 8:72904861-72904883 TGCAAAGGATGGAGGGAAGAAGG - Intronic
1043296180 8:78666165-78666187 GTGAGGCGATGAAGGGATGAGGG + Intronic
1043322664 8:79009389-79009411 GAGAAGGGAGGGAGGGAAGAGGG - Intergenic
1043322674 8:79009416-79009438 GGGAAGGGAGGGAGGGAAGAGGG - Intergenic
1043639016 8:82425663-82425685 GTCAGGGGTTGGGGGAAGGAAGG - Intergenic
1043986401 8:86697786-86697808 GTCATGGGGTGGGGGGAGGAGGG - Intronic
1044257370 8:90081775-90081797 GACAGAGAAGGGAGGGAAGAAGG - Intronic
1044405788 8:91824466-91824488 GTCAGGGGGTGGGGGGAAAGGGG + Intergenic
1044624528 8:94223787-94223809 GAGGGGGGATGGAGGGAAAATGG + Intergenic
1044750492 8:95411167-95411189 GGCAGGGGAAGGAGGACAGAAGG - Intergenic
1045244584 8:100431827-100431849 GAGAGGGGAGGAAGGGAAGAAGG - Intergenic
1045525676 8:102939717-102939739 GACAGGGGATCCAGGAAAGATGG - Intronic
1045611317 8:103846345-103846367 GTAAGGGAATGGAGTGAAGCAGG + Intronic
1045944557 8:107781145-107781167 GTCAGGGGAATCAGGGAGGATGG - Intergenic
1046007771 8:108506427-108506449 CTCAGGGGGTGGAGCCAAGATGG - Intergenic
1046066808 8:109207137-109207159 AGTAGGGGATGGAGGGAGGAGGG + Intergenic
1046698329 8:117369897-117369919 GTCAGGGGTTGGATGGAGAAAGG - Intergenic
1046875571 8:119251221-119251243 GCCAGGGGCTGGAAGGAGGAGGG + Intergenic
1047135956 8:122078709-122078731 GGGAAGGGAGGGAGGGAAGAGGG + Intergenic
1047346908 8:124037704-124037726 GGCATGGGGTGGAGGGTAGAGGG + Intronic
1047370805 8:124254249-124254271 GGCCGGGGCTGGAGTGAAGATGG + Intergenic
1047437276 8:124845284-124845306 GTCATGGGGTGGGGGGAAGGGGG - Intergenic
1047784603 8:128141801-128141823 GTTTGGTGATGGAGGCAAGAGGG + Intergenic
1047907935 8:129492743-129492765 GTCAGGGGGTGGGGGGAAAGGGG + Intergenic
1047941209 8:129829210-129829232 CTCAGGGGAAGGAGGGAGCAGGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048544375 8:135372683-135372705 GTGAGGACATGGGGGGAAGATGG + Intergenic
1048599607 8:135905966-135905988 TTCAGGGGATGGAGATAAGCGGG - Intergenic
1048690385 8:136955955-136955977 GAGAGGGGAGGGAGGGAGGAAGG - Intergenic
1048726879 8:137396274-137396296 GTCAGGGGATGGTTGGAAGAAGG - Intergenic
1048987020 8:139740200-139740222 GCCAGGGACAGGAGGGAAGAGGG - Intronic
1049065991 8:140314596-140314618 GTCTGGGGATGGTTGGGAGAAGG - Intronic
1049272397 8:141702883-141702905 GAGAGGGGAAGGAGGAAAGAAGG - Intergenic
1049398843 8:142415815-142415837 GTCAAGGCATGGATGGAAGCTGG - Intergenic
1049553055 8:143269544-143269566 GGCAGGGGATGCAGGGTGGAGGG - Intronic
1049773013 8:144392424-144392446 GTCTGGGGAGGGAGGGAGGGAGG - Exonic
1050603609 9:7277830-7277852 GTCATGGGATGGGGGGATGAGGG - Intergenic
1050871676 9:10579068-10579090 GTCAAGGGGTGGAGGACAGAGGG - Intronic
1050973066 9:11901683-11901705 GGAAGGGAATGGATGGAAGAGGG - Intergenic
1051328061 9:15994431-15994453 GTCATGGGGTGGAGGGAGCAGGG + Intronic
1051687735 9:19675842-19675864 GTCAGGGGAGGGGGTGAATAGGG - Intronic
1052053646 9:23879486-23879508 GTCAGGGAAAGGAGGGAATAGGG - Intergenic
1052068310 9:24050594-24050616 GTCATGGGATGGGGGGAGGGGGG - Intergenic
1052146591 9:25058291-25058313 GTCAGGGGATGGGGGGCAAGCGG - Intergenic
1052290779 9:26837600-26837622 GTCGGGGAGTGGCGGGAAGAGGG + Intergenic
1052317133 9:27127122-27127144 GTCAGGGGATTGGGGGTTGAGGG - Intronic
1052328126 9:27239367-27239389 GTCAGGGGGTGGAGCCAAGATGG + Intergenic
1052635025 9:31092239-31092261 TTCAGAGAATGGAGGGTAGAAGG - Intergenic
1052733396 9:32315651-32315673 GTTGGGGGAAGAAGGGAAGAAGG + Intergenic
1052775534 9:32729013-32729035 GTCAGGGGGAGGAGCCAAGATGG + Intergenic
1052886366 9:33652036-33652058 GACAGGGGAAGGAGGGAGCAGGG - Intergenic
1052974816 9:34402614-34402636 GCCTGAGGAGGGAGGGAAGAGGG + Intronic
1053048992 9:34942845-34942867 GTCATGGGATGGGGGGCAGGGGG + Intergenic
1053704433 9:40736197-40736219 GTCAGGGGTTGGAGGGGAAGAGG - Intergenic
1054414518 9:64859807-64859829 GTCAGGGGTTGGAGGGGAAGAGG - Intergenic
1054454038 9:65420439-65420461 GGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1054805552 9:69393320-69393342 GACAAGGGATGGAGGAAAGGAGG + Intergenic
1054813855 9:69455958-69455980 GTCAGGGGATGGAGGGACAGGGG - Intronic
1055354740 9:75426342-75426364 GAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1056032443 9:82567210-82567232 GTCAAGGGAGGAAGGGATGAAGG + Intergenic
1056084751 9:83135343-83135365 GTCGTGGGGTGGGGGGAAGAGGG + Intergenic
1056449236 9:86699443-86699465 GTCAGCAGAGGGAGGGAAGGAGG + Intergenic
1056861596 9:90189716-90189738 GTCAGGGGGTGGGGGGCAAAGGG - Intergenic
1056917128 9:90755786-90755808 GACAAGTGATGGAGGGAGGATGG - Intergenic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1058126915 9:101205976-101205998 GTCAACTGATGGTGGGAAGAGGG + Intronic
1058216767 9:102243393-102243415 GTCAGCTGATTGAGGGGAGAGGG - Intergenic
1058227127 9:102379226-102379248 GTCAGGGGATGGGGGGGCTAGGG - Intergenic
1058227813 9:102388237-102388259 TTTAGGGGATGGATGGGAGAGGG + Intergenic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1058901459 9:109446136-109446158 GTTAGGGGAGGGCAGGAAGAAGG + Intronic
1058951838 9:109911114-109911136 GTCAGAGGCTGGAGGTCAGAAGG + Intronic
1059341234 9:113598676-113598698 GTAAGGGGAGGCAGGGAGGAGGG - Intergenic
1059458161 9:114412757-114412779 GTAAGGGGATGAAATGAAGAGGG + Intronic
1059492829 9:114683321-114683343 GTCGTGGGGTGGGGGGAAGAGGG - Intergenic
1059994629 9:119896809-119896831 GGAAGGGAAGGGAGGGAAGAAGG + Intergenic
1060699199 9:125736106-125736128 GCCAGGGGCTGTGGGGAAGAGGG + Intergenic
1060849349 9:126861124-126861146 GTACGGGGAGGGAGGGCAGATGG + Intronic
1060916370 9:127393789-127393811 TTCATGAGATGCAGGGAAGAAGG - Intergenic
1061207869 9:129174924-129174946 CCCAGTGGATGGAGGGAGGAAGG - Intergenic
1061255768 9:129453663-129453685 GATAGGGAATGGAGGGATGAGGG + Intergenic
1061390532 9:130315181-130315203 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1061511323 9:131062908-131062930 ATCAGGGGCTGGAGGGAGGAAGG - Intronic
1061660822 9:132129157-132129179 GTCAGGGGCTGGAGGGAGAGGGG - Intergenic
1061690327 9:132322387-132322409 GTCAGGGGAAGGAAGGAGGGGGG - Intronic
1061874970 9:133539114-133539136 GTGAGGGGCTGGAGGGAGGCAGG + Intronic
1062020386 9:134316541-134316563 GGCAAGGGGTGGAGGGCAGAGGG - Intergenic
1062050541 9:134444501-134444523 GACGGGGGAAGGAGGGAAGGAGG - Intergenic
1062139112 9:134945680-134945702 GGCAGAGGGTGGAGGGCAGAGGG + Intergenic
1062194130 9:135263876-135263898 GAGAGGGGAAGGAGGGGAGAGGG - Intergenic
1062201670 9:135306132-135306154 GGAAGGGGAGGGAGGGAAGAAGG - Intergenic
1062390079 9:136330371-136330393 GACAGGGGAGGGAGGAAGGATGG - Intronic
1062423398 9:136494903-136494925 GGCAGGGGCTGGAGGGAGGCGGG - Exonic
1062513268 9:136919678-136919700 ATGAAGGGATGAAGGGAAGAAGG - Intronic
1062720012 9:138035591-138035613 ATCAAGGGAAGGAGGGAAGGAGG - Intronic
1185495289 X:549972-549994 GTGGGTGGATGGATGGAAGAAGG - Intergenic
1185867868 X:3639297-3639319 GTCGGGGGGTGGATGGATGAAGG + Intronic
1185917671 X:4053890-4053912 GTCAGGGGGTGGAGGGCAAAGGG - Intergenic
1186020607 X:5251177-5251199 GGCAGGGGAGAGAGGGAAGAAGG + Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186307153 X:8274134-8274156 GCCAGGGGCTGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186371959 X:8955877-8955899 CTCATGAGATGGAGGAAAGAGGG - Intergenic
1186438904 X:9567760-9567782 GGCAAGGGATGGGGGCAAGATGG - Intronic
1186603698 X:11066233-11066255 GAGAGGGGAGGGAGGGAATAGGG - Intergenic
1186763468 X:12747145-12747167 GTCATGGGGTGGGGGGAAGGGGG + Intergenic
1187145837 X:16636509-16636531 GCCAGGGGCTGGCGGGAAGTAGG + Intronic
1187354474 X:18554210-18554232 GTCATGGGATGGGGGGAAGGGGG - Intronic
1187814314 X:23214572-23214594 GTCAGGGGATGGGGGGCAAGGGG + Intergenic
1187886717 X:23895487-23895509 ATCAGGGGATGGAGGGCAAGGGG + Intronic
1187990771 X:24869757-24869779 GTTTGTGGATGGAGGAAAGAAGG - Intronic
1188410013 X:29860505-29860527 GTCAGGGGGTGGAGGGATAGGGG - Intronic
1188675089 X:32929707-32929729 GTCAGGGGGTGGGGGGCAAAGGG - Intronic
1188710882 X:33396081-33396103 GTCAGGGGGTAGGGGGAAAAGGG - Intergenic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1188817735 X:34736169-34736191 ATCAGAGGATGGAGGGTAGGAGG - Intergenic
1188821007 X:34775064-34775086 GTCAGGGGTTGGGGGGAAAGTGG + Intergenic
1189220552 X:39368089-39368111 GATAAAGGATGGAGGGAAGAAGG - Intergenic
1189608113 X:42701814-42701836 GTGAGGGGATGTAGGGAATTTGG - Intergenic
1189618528 X:42810826-42810848 GTCAGGGGATGGGGGGCTGGGGG - Intergenic
1189700825 X:43715388-43715410 GCTAGGGGATGCAGGGAAGATGG + Intronic
1189702050 X:43721834-43721856 GTCAGGGGATGGGGGGCTCAGGG - Intronic
1189728263 X:43990677-43990699 GGCAGGGGAGTGAGGGAAGCAGG - Intergenic
1189999184 X:46668733-46668755 GCCAGGGGCTGCAGGGAAGGGGG + Intronic
1190055040 X:47176350-47176372 GAGAGCGGATGGAGGGAAGAAGG - Intronic
1190102742 X:47534752-47534774 GTTAGGGGCTGGAGGGAGGGAGG + Intergenic
1190522756 X:51297012-51297034 GTCATGGGGTGGGGGGAGGAGGG + Intergenic
1190691154 X:52914523-52914545 GGCAGGGAATGGAGGGTTGATGG - Intergenic
1190694829 X:52941269-52941291 GGCAGGGAATGGAGGGTTGATGG + Intronic
1190749868 X:53352730-53352752 GCCAGGGGTTTGAGGGAAGGAGG + Intergenic
1191121968 X:56915419-56915441 GTCATGGGATGGGGGGATGGGGG - Intergenic
1192199293 X:69054885-69054907 GTCATGGGGTGGGGGGCAGAGGG + Intergenic
1192319912 X:70082313-70082335 GACAGAGGATGAAGTGAAGAAGG + Intergenic
1192464447 X:71344128-71344150 GCCAGGGGTTGGGGGGAAGAGGG + Intergenic
1192628021 X:72750299-72750321 GTCAGGGGGTGGAGGGATGGGGG - Intergenic
1192653688 X:72970509-72970531 GTCAGGGGGTGGAGGGATGGGGG + Intergenic
1193096557 X:77555701-77555723 GTCAGGGGGTGGGGGGAAAGGGG + Intronic
1193315521 X:80060692-80060714 GTCATGGGGTGGAGGGATGGGGG - Intergenic
1193567616 X:83097474-83097496 GTCATGGGGTGGAGGGAGCAGGG + Intergenic
1193599805 X:83496348-83496370 TACATGGGGTGGAGGGAAGAGGG + Intergenic
1193653738 X:84171827-84171849 GTCGGGGGTTGGCGGGAAAAGGG - Intronic
1193752927 X:85369439-85369461 GTAAGTGAATGGAGGAAAGATGG - Intronic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1194512849 X:94816538-94816560 GTCAGGGGTTGGGGGTAAGGAGG - Intergenic
1194956725 X:100189662-100189684 ATCAGAGTGTGGAGGGAAGAAGG + Intergenic
1195047443 X:101066894-101066916 GTCATGGGGTGGAGGGCAGGGGG + Intergenic
1195516572 X:105783404-105783426 GCCTGGGGAAGGAGGGAAGTAGG - Intergenic
1195588569 X:106597224-106597246 ATTAGGGGGTGGAGGGTAGATGG + Intergenic
1195890422 X:109687572-109687594 GTCAGGGGATGGAGGGCTAGGGG + Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1195977374 X:110542273-110542295 TTCAGAGGATGGAGGGAGGGAGG - Intergenic
1196031313 X:111097299-111097321 GGTGGGGGATGGTGGGAAGAGGG + Intronic
1196622947 X:117844476-117844498 GTCATGGGATGGGGGGAGGGGGG + Intergenic
1196830091 X:119768971-119768993 ATGAAGGGAAGGAGGGAAGATGG - Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197075160 X:122344321-122344343 GTCAGGGGTTGGGGGGAAATGGG + Intergenic
1197398880 X:125964069-125964091 GGAAGGGGAGGGAGGGAAGGAGG + Intergenic
1197487271 X:127068700-127068722 GTCAGGGGTTGGGGGGAAAAAGG - Intergenic
1197520019 X:127485974-127485996 GTCAGTGGGTGGAGGGAGAAGGG - Intergenic
1197751384 X:129966174-129966196 GACAGAGAATGGAGGGAAGTTGG - Intergenic
1197762876 X:130039958-130039980 GGCAGGGGGAGGAGGGAAGGAGG + Intronic
1197908338 X:131451190-131451212 GTCATGGGGTGGAGGGAGGGTGG + Intergenic
1198232706 X:134707449-134707471 GTCAGAGGATGGAGGGCTGGGGG - Intronic
1198311141 X:135426374-135426396 GGCGGGGGAGGGAGGGCAGAGGG + Intergenic
1198806857 X:140502217-140502239 GTCAGGGACTGGAGGAAAGTGGG + Intergenic
1199000548 X:142631388-142631410 GTCAGGGGATGGGGGGCTGGGGG + Intergenic
1199122240 X:144069399-144069421 GTCAGGGGGTGGAGGGTTGGGGG - Intergenic
1199344624 X:146723956-146723978 GTCAGGGGCTGGAGGGCTGGGGG + Intergenic
1199589880 X:149457501-149457523 TTCAGGGCATCGAGAGAAGAGGG + Intergenic
1199688827 X:150290741-150290763 ATCAGCAGATGGAGGGAAGCAGG - Intergenic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1199778314 X:151034968-151034990 GACAGAGGATGGAGAGAAGGAGG - Intergenic
1199880520 X:151970913-151970935 GGAAGGGGATGAAGGGAAGGAGG + Intronic
1200296081 X:154921875-154921897 GTTGGGGGGTGGGGGGAAGAGGG + Intronic
1200650816 Y:5838195-5838217 GTCATGGGATGGGGGGCAGGGGG + Intergenic
1200695775 Y:6357891-6357913 GAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1200883443 Y:8244530-8244552 GTCATGGGATGGGGGGAGGGGGG + Intergenic
1201039502 Y:9816819-9816841 GAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1201298243 Y:12483992-12484014 GCCAGGGGCTGGAGGGGAAAAGG - Intergenic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic
1201454563 Y:14155478-14155500 GTCATGGGGTGGGGGGAGGAGGG + Intergenic
1201672414 Y:16538823-16538845 GTCAGGGGATGGGGGGCCAAGGG - Intergenic
1201935876 Y:19410674-19410696 GCCAGGGGAGGGAAGAAAGATGG + Intergenic