ID: 909432477

View in Genome Browser
Species Human (GRCh38)
Location 1:75605635-75605657
Sequence CCCATTAGGGCCCATGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909432477_909432486 30 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432486 1:75605688-75605710 ACTATGGGAATCCACAGAAGGGG 0: 1
1: 0
2: 2
3: 20
4: 197
909432477_909432485 29 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432485 1:75605687-75605709 TACTATGGGAATCCACAGAAGGG 0: 1
1: 0
2: 2
3: 24
4: 228
909432477_909432484 28 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432484 1:75605686-75605708 ATACTATGGGAATCCACAGAAGG No data
909432477_909432483 15 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432483 1:75605673-75605695 ATAAAATTCGATTATACTATGGG 0: 1
1: 0
2: 1
3: 15
4: 181
909432477_909432482 14 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG 0: 1
1: 0
2: 1
3: 11
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909432477 Original CRISPR CCCATTAGGGCCCATGACAG AGG (reversed) Intronic
No off target data available for this crispr