ID: 909432480

View in Genome Browser
Species Human (GRCh38)
Location 1:75605649-75605671
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909432480_909432484 14 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432484 1:75605686-75605708 ATACTATGGGAATCCACAGAAGG No data
909432480_909432482 0 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG 0: 1
1: 0
2: 1
3: 11
4: 201
909432480_909432483 1 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432483 1:75605673-75605695 ATAAAATTCGATTATACTATGGG 0: 1
1: 0
2: 1
3: 15
4: 181
909432480_909432486 16 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432486 1:75605688-75605710 ACTATGGGAATCCACAGAAGGGG 0: 1
1: 0
2: 2
3: 20
4: 197
909432480_909432485 15 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432485 1:75605687-75605709 TACTATGGGAATCCACAGAAGGG 0: 1
1: 0
2: 2
3: 24
4: 228
909432480_909432487 17 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432487 1:75605689-75605711 CTATGGGAATCCACAGAAGGGGG 0: 1
1: 0
2: 4
3: 27
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909432480 Original CRISPR ACTTTTGGTAGTTTCCCATT AGG (reversed) Intronic