ID: 909432481

View in Genome Browser
Species Human (GRCh38)
Location 1:75605664-75605686
Sequence TAATCGAATTTTATAACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909432481_909432485 0 Left 909432481 1:75605664-75605686 CCAAAAGTTATAAAATTCGATTA No data
Right 909432485 1:75605687-75605709 TACTATGGGAATCCACAGAAGGG 0: 1
1: 0
2: 2
3: 24
4: 228
909432481_909432487 2 Left 909432481 1:75605664-75605686 CCAAAAGTTATAAAATTCGATTA No data
Right 909432487 1:75605689-75605711 CTATGGGAATCCACAGAAGGGGG 0: 1
1: 0
2: 4
3: 27
4: 567
909432481_909432489 19 Left 909432481 1:75605664-75605686 CCAAAAGTTATAAAATTCGATTA No data
Right 909432489 1:75605706-75605728 AGGGGGTAAAGAGAAAGCAAAGG 0: 1
1: 0
2: 1
3: 67
4: 651
909432481_909432486 1 Left 909432481 1:75605664-75605686 CCAAAAGTTATAAAATTCGATTA No data
Right 909432486 1:75605688-75605710 ACTATGGGAATCCACAGAAGGGG 0: 1
1: 0
2: 2
3: 20
4: 197
909432481_909432484 -1 Left 909432481 1:75605664-75605686 CCAAAAGTTATAAAATTCGATTA No data
Right 909432484 1:75605686-75605708 ATACTATGGGAATCCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909432481 Original CRISPR TAATCGAATTTTATAACTTT TGG (reversed) Intronic