ID: 909432482

View in Genome Browser
Species Human (GRCh38)
Location 1:75605672-75605694
Sequence TATAAAATTCGATTATACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909432477_909432482 14 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG 0: 1
1: 0
2: 1
3: 11
4: 201
909432473_909432482 30 Left 909432473 1:75605619-75605641 CCATGACTTTAATGTTCCTCTGT 0: 1
1: 0
2: 4
3: 25
4: 236
Right 909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG 0: 1
1: 0
2: 1
3: 11
4: 201
909432480_909432482 0 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG 0: 1
1: 0
2: 1
3: 11
4: 201
909432479_909432482 1 Left 909432479 1:75605648-75605670 CCCTAATGGGAAACTACCAAAAG 0: 1
1: 0
2: 1
3: 11
4: 229
Right 909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG 0: 1
1: 0
2: 1
3: 11
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909432482 Original CRISPR TATAAAATTCGATTATACTA TGG Intronic
901176778 1:7307712-7307734 TATAAAAGAAGAATATACTATGG - Intronic
902741476 1:18441565-18441587 AATAAAATAGGCTTATACTATGG - Intergenic
905864927 1:41371537-41371559 TATAAAATAGGATAATAATAGGG + Intronic
906570904 1:46838581-46838603 TATAAACGTCAATTAGACTAAGG + Intergenic
906600370 1:47122872-47122894 TATAAACGTCAATTAGACTAAGG - Intergenic
908917515 1:69147395-69147417 TATAAAATGATATTATAATAAGG - Intergenic
909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG + Intronic
911636451 1:100241272-100241294 TTTAAAATAATATTATACTAAGG - Intronic
911958964 1:104273978-104274000 TATAAAATTAAATATTACTAAGG + Intergenic
913064776 1:115240599-115240621 TTTAAAATTATTTTATACTAAGG - Intergenic
915615031 1:157031056-157031078 TATAAAATTCATTTATATGATGG + Intronic
915996510 1:160569374-160569396 TCTGAAATTAGATTTTACTAAGG - Intronic
916375409 1:164148335-164148357 TATAAAATTCTACTCTAATAGGG - Intergenic
919034374 1:192287396-192287418 GATAAAATTCCATTATAAAATGG - Intergenic
921682169 1:218046874-218046896 TATCAAATTCCATTAGACAAGGG - Intergenic
1063682842 10:8206729-8206751 TATAAAATTCTATTTTCCTATGG - Intergenic
1065288107 10:24204368-24204390 TATAGAAATGTATTATACTATGG + Intronic
1065406680 10:25373842-25373864 TATAAAATTTGAATATACAGTGG - Intronic
1068526481 10:58135931-58135953 TATAAAATTAGATTATTTGAAGG - Intergenic
1069500052 10:68944156-68944178 AATAAAATTGGATGATATTAAGG - Intronic
1072010686 10:91300471-91300493 TATAAAATTCCATTTTACTATGG + Intergenic
1072160165 10:92758957-92758979 TATAAAATTTGCTAATACTAAGG - Intergenic
1074029139 10:109666759-109666781 TTTAAAATTCGTTGCTACTATGG - Intergenic
1079508543 11:21183179-21183201 TATAAGATTATATTATACTGAGG - Intronic
1082725596 11:56731594-56731616 TATAAAATCAAATTATACTGAGG + Intergenic
1082931214 11:58607821-58607843 TATAGTATTCAATCATACTAAGG + Intronic
1082941936 11:58715073-58715095 AATAAAACTTGATTAAACTATGG - Intronic
1086609930 11:88743395-88743417 GATAAAGTTCCATTATACTCAGG - Intronic
1086997125 11:93370731-93370753 TAAAAAATTCAATTATACAATGG - Intronic
1088145044 11:106666425-106666447 TTTAAAATTCCATTAAAATATGG - Intergenic
1088605577 11:111527562-111527584 TTTAAAATCAGATTATACTGGGG + Intronic
1090737854 11:129626845-129626867 TATACAATTTGATTATAATGTGG - Intergenic
1090923186 11:131225817-131225839 TATAAAATCCCATTATACATTGG + Intergenic
1091570969 12:1685645-1685667 TAAAAAATTTGACAATACTAAGG + Intergenic
1091780470 12:3211182-3211204 TATAAATTCCAAATATACTAAGG - Intronic
1093142940 12:15530726-15530748 TATAAAATTCCCTCATACTATGG - Intronic
1093255639 12:16863885-16863907 TATAAAAGTGGTTTATACAAAGG - Intergenic
1093651242 12:21648086-21648108 TATGAAATTCCATTATCTTATGG + Intronic
1094046545 12:26173726-26173748 TATAAAATTTGAAGATACAATGG - Intronic
1094153036 12:27307086-27307108 TATAAAATACAATGGTACTATGG - Intronic
1094516749 12:31136337-31136359 TATAAAATTTGAGTATAGAAAGG + Intergenic
1097595783 12:61627895-61627917 TAAAAAATGCCAATATACTATGG + Intergenic
1098967678 12:76809340-76809362 TATAAGATTGGATTAAACTTTGG + Intronic
1099069407 12:78026685-78026707 TTTAAAATGCAATTATTCTAGGG - Intronic
1105695944 13:22888736-22888758 TAAAAAATTATATAATACTACGG + Intergenic
1105807044 13:23959115-23959137 TATAAAATTCCGTTAAACTGAGG + Intergenic
1106729771 13:32528368-32528390 TTTAAAGTTTGATTATACTTTGG - Intronic
1107621723 13:42239155-42239177 AATTAATTTCAATTATACTAAGG - Intronic
1108961649 13:56240715-56240737 TATAAAATTTAAATATACTGAGG - Intergenic
1109000868 13:56803260-56803282 TAGAAAATTTGTTTATACCATGG + Intergenic
1110026042 13:70540545-70540567 CATAAAATGAGATTATCCTATGG + Intergenic
1110325662 13:74211832-74211854 TATAAAATTTGGTTATAGGAGGG + Intergenic
1110792921 13:79605305-79605327 TATAAATATCGATTGTACTTTGG + Intergenic
1110864703 13:80381032-80381054 TATGAAATTGAATTATACCATGG - Intergenic
1111110578 13:83703538-83703560 TGCAAAATTCCATTATACCATGG + Intergenic
1112830932 13:103450128-103450150 TATAAAATTTGAATTTAATATGG - Intergenic
1113089765 13:106604923-106604945 TTAAAAATCTGATTATACTAAGG - Intergenic
1115128406 14:30023881-30023903 TATAAAGTTTGATGGTACTAGGG + Intronic
1116323580 14:43500942-43500964 TATAAAATATAATTTTACTAAGG + Intergenic
1116833082 14:49741682-49741704 TTTAAAATTTGATAAAACTAAGG + Intronic
1118493757 14:66287459-66287481 TATAAAATGAGATTGTAGTATGG + Intergenic
1118534300 14:66742538-66742560 TCTAAAAATCAATTCTACTATGG - Intronic
1125078904 15:35653722-35653744 TTTAAAATTCAATGATTCTAGGG + Intergenic
1125166664 15:36714086-36714108 AAAAAAATTTGATTGTACTAAGG - Intronic
1125493741 15:40170072-40170094 TATGAAATTCGATTTTACACTGG + Exonic
1126187644 15:45846318-45846340 TAGAAAATTTGAGTATAGTAAGG + Intergenic
1126449062 15:48785656-48785678 TGTAAAAATCAATTAAACTATGG + Intronic
1128942965 15:71803429-71803451 TATACAATTAGAATATATTAAGG - Intronic
1131503517 15:92994426-92994448 TATCAAATTCAATAATATTAAGG - Intronic
1134861474 16:17564325-17564347 TATAAAATGGTATTACACTAAGG - Intergenic
1138946937 16:61863002-61863024 TATCAAGTTGGATTATAATAGGG - Intronic
1143915243 17:10286891-10286913 CATAAAAATAGATTATATTAAGG - Intergenic
1145723625 17:27096226-27096248 TATAAAATTCAATTTTTTTAGGG - Intergenic
1146435015 17:32836756-32836778 TATTACATTAGATTATACCACGG + Intronic
1151064362 17:71133296-71133318 TATAAAATGCTATTATCCCATGG - Intergenic
1151094346 17:71479000-71479022 TATACAATTCTATTTTACTAAGG + Intergenic
1153818607 18:8812837-8812859 AATAAAATTTGTTTATACTGTGG + Intronic
1156082984 18:33362505-33362527 AATAAAATTGTATTATATTAGGG + Intronic
1156179194 18:34583195-34583217 TACAACATTCAATTAGACTAAGG - Intronic
1158701251 18:59749567-59749589 TATACAATTCACTTATACAAAGG - Intergenic
1158842213 18:61399803-61399825 TAAAAAATACAATTACACTAAGG + Intronic
1159366504 18:67472576-67472598 TATACAATTCAATTATAATAAGG + Intergenic
1159382834 18:67685080-67685102 TATAAAAATCACTTAAACTAGGG - Intergenic
1159688882 18:71460265-71460287 TACAAAATTGGAATATTCTATGG + Intergenic
1159764615 18:72473237-72473259 TATAAAATTGAATTTTACTCTGG - Intergenic
1164482233 19:28620923-28620945 GATAAAATTTTATTATACGAAGG - Intergenic
925983559 2:9196638-9196660 TATAATATTCCATTATTTTATGG + Intergenic
926655083 2:15394459-15394481 TGTAAAATTGGATTACACTATGG - Intronic
926713212 2:15900205-15900227 TAAACAATTTGATGATACTATGG - Intergenic
930635073 2:53795535-53795557 TATAAGATTCAACTATTCTAAGG + Intronic
931326214 2:61227228-61227250 AATAAAATTCAATTTTAATACGG + Intronic
931593712 2:63915932-63915954 TAAACAATTCTATTATACTACGG + Intronic
933857102 2:86426359-86426381 TTTAAAATTCTCTTCTACTATGG + Intergenic
935701396 2:105815359-105815381 AATAGAATTCGATTTTTCTATGG + Intronic
935827630 2:106967509-106967531 TTTTAAATTAAATTATACTATGG + Intergenic
938660267 2:133479779-133479801 CATAAATTTCGATTATTCTGTGG - Intronic
939136694 2:138304394-138304416 TAAAGAATTAGATTATACTGAGG + Intergenic
939619152 2:144396985-144397007 TATAAAATTCAATTAAAATCGGG - Intronic
939844822 2:147230233-147230255 TACAAAATTTGCTTATAATAGGG + Intergenic
940164761 2:150758299-150758321 TCTAAAATTCTATTCTTCTATGG + Intergenic
940697625 2:156999427-156999449 GATAAAATTCAATTATACACAGG + Intergenic
942041676 2:172071248-172071270 TATAAAAATGAATTATACCAGGG + Intronic
943555503 2:189398966-189398988 TATGGAATTCAATTATTCTATGG - Intergenic
943631441 2:190257295-190257317 TATGGAATTCGATTCTACTCTGG - Intronic
943845932 2:192648257-192648279 TATAAAATTCGTATAAAATATGG + Intergenic
944403149 2:199351703-199351725 TATAAAATAAGATTTTACTGTGG - Intronic
944758564 2:202789538-202789560 TACAAAAGTTGATTATACTAAGG + Intronic
945531689 2:210962216-210962238 TTTAAAATTCTACTATTCTAAGG - Intergenic
945754857 2:213833339-213833361 TATAAAATATGGTTATACCAGGG - Intronic
1169104316 20:2981193-2981215 AATAATATTAGATGATACTAAGG + Intronic
1170484477 20:16802676-16802698 TATAATATTTCATGATACTAGGG - Intergenic
1177107172 21:16973997-16974019 TAGAAAATTAGATAATACTATGG - Intergenic
1177629560 21:23709019-23709041 TTGAAAATTCGATTTTATTAGGG + Intergenic
1177691090 21:24508272-24508294 TATAAAATTAAATTAAATTATGG - Intergenic
951278066 3:20713605-20713627 TATTCAATTTCATTATACTAGGG + Intergenic
953480174 3:43244584-43244606 TATAAAAATAGATAATACCAAGG - Intergenic
953799963 3:46015307-46015329 TATAAAATGAGATTATGCTGAGG - Intergenic
955017022 3:55080731-55080753 TATGTCATTAGATTATACTAGGG - Intergenic
955779633 3:62470686-62470708 TCTCAGATTCAATTATACTAAGG + Intronic
956008764 3:64808157-64808179 TATAAAATACAATTTTGCTAAGG + Intergenic
956920460 3:73923200-73923222 TATAACATTGTATTATACTGTGG + Intergenic
957330982 3:78763457-78763479 TTTCAAATTTGATTATAATATGG - Intronic
958992407 3:100862270-100862292 TAAAAAAATCGATTATAACAAGG - Intronic
958993819 3:100878252-100878274 TATAAAATTGTGTTATACTGTGG - Intronic
959231582 3:103660512-103660534 TAGAAAATTTGATCATATTATGG + Intergenic
963585772 3:147186145-147186167 TATCAAATTCCACTATTCTAAGG - Intergenic
964233055 3:154493140-154493162 TCTCAAATACCATTATACTAGGG - Intergenic
964482460 3:157155198-157155220 CATAAAATTACATTTTACTAGGG - Intronic
965663911 3:171071022-171071044 TATAAAATTAGATTAAAATTTGG - Intronic
965856628 3:173096848-173096870 TATAATATTCCATCATGCTAAGG - Intronic
970935535 4:21565825-21565847 TATAAAATGGGATTAGACCATGG + Intronic
971999455 4:34011703-34011725 TATAAAAACCTATTATATTAGGG - Intergenic
972111690 4:35569583-35569605 TATAAAAGCCAATTATAATAAGG + Intergenic
975370626 4:73582317-73582339 TTTAAAATTATATTATATTAAGG + Intronic
977642795 4:99376118-99376140 TATAAAATTTCATATTACTAAGG - Intergenic
978862383 4:113465949-113465971 TTTAAAATTAGTTTTTACTAAGG + Intronic
979490651 4:121323492-121323514 CATAAAATTCCATAGTACTAAGG - Intergenic
981852999 4:149253793-149253815 TAAGCAATTCGATTATGCTATGG - Intergenic
982944846 4:161607428-161607450 TATAAAATACTATAAAACTATGG + Intronic
982988075 4:162235215-162235237 TGAAAAATTCGAAGATACTAAGG - Intergenic
983242677 4:165251551-165251573 TATAAGATGCTCTTATACTAAGG - Intronic
984460315 4:180027960-180027982 TTTAAAATTACATTATACTCAGG - Intergenic
984470301 4:180161898-180161920 TATAAAATGCCAAAATACTATGG - Intergenic
985904353 5:2821866-2821888 TATAAAAGTCGTTAATACTTTGG - Intergenic
986691005 5:10313928-10313950 TATACAATTCTCTTAAACTATGG - Intergenic
987438183 5:17923870-17923892 TATAATTTTCCATTACACTAAGG + Intergenic
987575327 5:19720868-19720890 TATAAAATTGTATTGTACTGGGG - Intronic
993069865 5:83147104-83147126 TTTAAAACACGATGATACTAAGG - Intronic
993549146 5:89251836-89251858 TATAAAATTAGGTTTTTCTAAGG + Intergenic
994493337 5:100476877-100476899 TTTAAAATTATATTACACTAGGG + Intergenic
994735826 5:103554622-103554644 TATAAAACTCGGTTATTTTAAGG - Intronic
995243814 5:109915118-109915140 GATAAAATTAGTTTATACTCAGG - Intergenic
995563617 5:113409880-113409902 TATAAAATTTTATTTTAATAAGG + Intronic
996215616 5:120861622-120861644 TATAAAATTCTATGATAATATGG - Intergenic
997502856 5:134391598-134391620 CATAAAATTGGATTACAGTATGG + Exonic
1000909939 5:167009961-167009983 TAAAAAATTCAATTATATTTTGG - Intergenic
1003885395 6:10516994-10517016 TATAAAATTCAATCTTACTGCGG + Intronic
1009996849 6:70905455-70905477 TACAAAATTAAATTATACTTAGG + Intronic
1010999667 6:82573469-82573491 TAAAAAATGCCATTATTCTAGGG - Intergenic
1011123920 6:83986113-83986135 TAAAAAATTCCATTACACTGAGG - Intergenic
1012352734 6:98272845-98272867 TATAAAATTGAATTATATTCAGG + Intergenic
1014145499 6:117993748-117993770 TATAAAATTCATTTCTGCTAAGG - Intronic
1014267565 6:119298489-119298511 TGTAAAATTTGTTTATACTTAGG + Intronic
1014960656 6:127679915-127679937 TATAAAATTTGATTGTAGAAAGG + Intergenic
1015737310 6:136414517-136414539 TTTAAAATGCCATTTTACTACGG - Intronic
1016079492 6:139838473-139838495 TATAAAAATAGATAAAACTAAGG + Intergenic
1016111321 6:140229354-140229376 CTTAAAATTCAATTATAATATGG - Intergenic
1016347721 6:143132522-143132544 TATGAAATTTGATTACACTGGGG + Intronic
1020416591 7:7952900-7952922 TAAAAAATTGAATTATATTATGG + Intronic
1020447195 7:8281411-8281433 TATAAAATTACAATATATTAGGG - Intergenic
1022319250 7:29272993-29273015 AATAAAATTGTATTATATTAGGG - Intronic
1023224552 7:37955425-37955447 TATTAAATTCAATTATAAAATGG + Intronic
1023288206 7:38641717-38641739 TATAAAATGCTATTATCCCATGG - Intergenic
1024488954 7:49955096-49955118 TATAAAATTAGATAATATTTTGG + Intronic
1028959795 7:96735788-96735810 TATAAATGTGGATCATACTAAGG - Intergenic
1030218293 7:107069397-107069419 TATGAAATTTGTTTACACTATGG - Intronic
1030971204 7:116058699-116058721 TTTAAAATTTAATTATGCTATGG - Intronic
1032640123 7:133757196-133757218 TTTAAAATGCGATTATAGTGGGG + Intronic
1033845209 7:145423640-145423662 TATAGAATTAGATTATAGAATGG - Intergenic
1037933257 8:22897056-22897078 TATATAATCCAAATATACTACGG + Intronic
1038411281 8:27361651-27361673 TGTAAAATTAGGTCATACTAAGG + Intronic
1038772427 8:30495559-30495581 TATTAAATCAGATTATTCTAAGG + Intronic
1039147149 8:34461187-34461209 AATAAAATTGTATTATATTAGGG + Intergenic
1039274134 8:35916231-35916253 TACAAAATTTGATTATGGTAAGG + Intergenic
1039533228 8:38283579-38283601 GATAAAAATAGATTATAATAAGG + Intronic
1040733957 8:50483842-50483864 TACAAAATTCTATTAAAATAAGG + Intronic
1041248442 8:55911613-55911635 TGTGAAATTCCATTGTACTAGGG + Intronic
1041811646 8:61917347-61917369 TATAAACTACTATTAAACTATGG + Intergenic
1041964021 8:63653474-63653496 TGTAAAATTCTATTAGTCTATGG - Intergenic
1041992185 8:64006487-64006509 TATAAAATTCTACTATAATGAGG - Intergenic
1042405915 8:68405401-68405423 TATAAAATTACAATATCCTAGGG - Intronic
1043345533 8:79293826-79293848 TATAACCTTAGATTCTACTAGGG + Intergenic
1044339348 8:91028970-91028992 AATAAAATTCGATTAATCCATGG - Intronic
1045078839 8:98602601-98602623 TATAAATTTAGGTTTTACTATGG - Intronic
1045574684 8:103407739-103407761 TGTAAAATTCCATTATATTTCGG + Exonic
1050754235 9:8980335-8980357 AATAAAATTGTATTATATTAGGG + Intronic
1051316484 9:15839052-15839074 TATAAAATTCTATACTACAATGG + Intronic
1052131106 9:24847571-24847593 ATTAAAATTCTATTATACTGAGG - Intergenic
1053826926 9:42034923-42034945 TATAAGATATGATTAAACTAAGG + Intronic
1054603634 9:67152508-67152530 TATAAGATATGATTAAACTAAGG - Intergenic
1054820769 9:69518287-69518309 TATAAAAATCCATTATAAAATGG - Intronic
1058740067 9:107934121-107934143 CATAAAATTGGGTTATTCTAGGG - Intergenic
1061439578 9:130591578-130591600 TATAAATTACATTTATACTACGG - Intronic
1189143409 X:38630535-38630557 TTTAAAATTACATTATACTGAGG - Intronic
1189546376 X:42046516-42046538 AATAAACTTCTATTATACTGGGG - Intergenic
1189806749 X:44742902-44742924 TATAAAATCCGTTTTTACCATGG - Intergenic
1191904792 X:66076893-66076915 TATAATATTATATTATACTTTGG + Intergenic
1192833210 X:74772303-74772325 TAAAAAGTAGGATTATACTAGGG - Intronic
1195375569 X:104224246-104224268 AATAATATTCCATTATAATATGG - Intergenic
1197037835 X:121898159-121898181 TTAAAAATTTGATTATCCTAAGG - Intergenic
1197534356 X:127668969-127668991 TATACAAATGGATTATAATAAGG - Intergenic
1201183347 Y:11372023-11372045 TATAAAATTTAATAATATTAAGG + Intergenic
1201857695 Y:18563638-18563660 TAAAAATTGCGATTATATTACGG - Intronic
1201875626 Y:18756743-18756765 TAAAAATTGCGATTATATTACGG + Intronic