ID: 909432482 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:75605672-75605694 |
Sequence | TATAAAATTCGATTATACTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 214 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 201} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
909432480_909432482 | 0 | Left | 909432480 | 1:75605649-75605671 | CCTAATGGGAAACTACCAAAAGT | 0: 1 1: 0 2: 0 3: 22 4: 167 |
||
Right | 909432482 | 1:75605672-75605694 | TATAAAATTCGATTATACTATGG | 0: 1 1: 0 2: 1 3: 11 4: 201 |
||||
909432479_909432482 | 1 | Left | 909432479 | 1:75605648-75605670 | CCCTAATGGGAAACTACCAAAAG | 0: 1 1: 0 2: 1 3: 11 4: 229 |
||
Right | 909432482 | 1:75605672-75605694 | TATAAAATTCGATTATACTATGG | 0: 1 1: 0 2: 1 3: 11 4: 201 |
||||
909432477_909432482 | 14 | Left | 909432477 | 1:75605635-75605657 | CCTCTGTCATGGGCCCTAATGGG | No data | ||
Right | 909432482 | 1:75605672-75605694 | TATAAAATTCGATTATACTATGG | 0: 1 1: 0 2: 1 3: 11 4: 201 |
||||
909432473_909432482 | 30 | Left | 909432473 | 1:75605619-75605641 | CCATGACTTTAATGTTCCTCTGT | 0: 1 1: 0 2: 4 3: 25 4: 236 |
||
Right | 909432482 | 1:75605672-75605694 | TATAAAATTCGATTATACTATGG | 0: 1 1: 0 2: 1 3: 11 4: 201 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
909432482 | Original CRISPR | TATAAAATTCGATTATACTA TGG | Intronic | ||