ID: 909432482

View in Genome Browser
Species Human (GRCh38)
Location 1:75605672-75605694
Sequence TATAAAATTCGATTATACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909432480_909432482 0 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG 0: 1
1: 0
2: 1
3: 11
4: 201
909432477_909432482 14 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG 0: 1
1: 0
2: 1
3: 11
4: 201
909432479_909432482 1 Left 909432479 1:75605648-75605670 CCCTAATGGGAAACTACCAAAAG 0: 1
1: 0
2: 1
3: 11
4: 229
Right 909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG 0: 1
1: 0
2: 1
3: 11
4: 201
909432473_909432482 30 Left 909432473 1:75605619-75605641 CCATGACTTTAATGTTCCTCTGT 0: 1
1: 0
2: 4
3: 25
4: 236
Right 909432482 1:75605672-75605694 TATAAAATTCGATTATACTATGG 0: 1
1: 0
2: 1
3: 11
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909432482 Original CRISPR TATAAAATTCGATTATACTA TGG Intronic