ID: 909432483 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:75605673-75605695 |
Sequence | ATAAAATTCGATTATACTAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 198 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 15, 4: 181} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
909432477_909432483 | 15 | Left | 909432477 | 1:75605635-75605657 | CCTCTGTCATGGGCCCTAATGGG | No data | ||
Right | 909432483 | 1:75605673-75605695 | ATAAAATTCGATTATACTATGGG | 0: 1 1: 0 2: 1 3: 15 4: 181 |
||||
909432480_909432483 | 1 | Left | 909432480 | 1:75605649-75605671 | CCTAATGGGAAACTACCAAAAGT | 0: 1 1: 0 2: 0 3: 22 4: 167 |
||
Right | 909432483 | 1:75605673-75605695 | ATAAAATTCGATTATACTATGGG | 0: 1 1: 0 2: 1 3: 15 4: 181 |
||||
909432479_909432483 | 2 | Left | 909432479 | 1:75605648-75605670 | CCCTAATGGGAAACTACCAAAAG | 0: 1 1: 0 2: 1 3: 11 4: 229 |
||
Right | 909432483 | 1:75605673-75605695 | ATAAAATTCGATTATACTATGGG | 0: 1 1: 0 2: 1 3: 15 4: 181 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
909432483 | Original CRISPR | ATAAAATTCGATTATACTAT GGG | Intronic | ||