ID: 909432483

View in Genome Browser
Species Human (GRCh38)
Location 1:75605673-75605695
Sequence ATAAAATTCGATTATACTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909432480_909432483 1 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432483 1:75605673-75605695 ATAAAATTCGATTATACTATGGG 0: 1
1: 0
2: 1
3: 15
4: 181
909432479_909432483 2 Left 909432479 1:75605648-75605670 CCCTAATGGGAAACTACCAAAAG 0: 1
1: 0
2: 1
3: 11
4: 229
Right 909432483 1:75605673-75605695 ATAAAATTCGATTATACTATGGG 0: 1
1: 0
2: 1
3: 15
4: 181
909432477_909432483 15 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432483 1:75605673-75605695 ATAAAATTCGATTATACTATGGG 0: 1
1: 0
2: 1
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909432483 Original CRISPR ATAAAATTCGATTATACTAT GGG Intronic