ID: 909432483

View in Genome Browser
Species Human (GRCh38)
Location 1:75605673-75605695
Sequence ATAAAATTCGATTATACTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909432480_909432483 1 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432483 1:75605673-75605695 ATAAAATTCGATTATACTATGGG 0: 1
1: 0
2: 1
3: 15
4: 181
909432479_909432483 2 Left 909432479 1:75605648-75605670 CCCTAATGGGAAACTACCAAAAG 0: 1
1: 0
2: 1
3: 11
4: 229
Right 909432483 1:75605673-75605695 ATAAAATTCGATTATACTATGGG 0: 1
1: 0
2: 1
3: 15
4: 181
909432477_909432483 15 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432483 1:75605673-75605695 ATAAAATTCGATTATACTATGGG 0: 1
1: 0
2: 1
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909432483 Original CRISPR ATAAAATTCGATTATACTAT GGG Intronic
906498977 1:46326660-46326682 AAAAAATTATATAATACTATAGG - Intergenic
906997946 1:50817748-50817770 CTAAAATTAGATTATAGTGTTGG + Intronic
908578426 1:65487107-65487129 CAAAAATTCTATTATACAATTGG - Intronic
908854625 1:68411266-68411288 ATAAAATTGAGTTATACTCTAGG + Intergenic
909072307 1:71010651-71010673 ATAGAATTGGATTATCCTGTAGG - Intronic
909432483 1:75605673-75605695 ATAAAATTCGATTATACTATGGG + Intronic
909875843 1:80801711-80801733 TTATAATTGGATTATATTATAGG - Intergenic
911408318 1:97469629-97469651 ATAAAATTAAACTATACTAAAGG + Intronic
911519622 1:98912981-98913003 ATAAAATTTCCTTTTACTATAGG - Intronic
911623653 1:100095544-100095566 ATAAAAATAAATTGTACTATCGG + Intronic
913563030 1:120042393-120042415 ATAAAACTCCATTCTACTTTAGG + Intronic
913635093 1:120751197-120751219 ATAAAACTCCATTCTACTTTAGG - Intergenic
914621970 1:149418518-149418540 ATAAAACTCCATTCTACTTTAGG - Intergenic
915789304 1:158650774-158650796 TTCAAATTCAATTATATTATTGG + Intronic
917363250 1:174200503-174200525 GTAAAATATGATTATTCTATAGG - Intronic
917698258 1:177552184-177552206 AAAAAATTCCATTATAATGTGGG - Intergenic
918807213 1:189064228-189064250 ATAAAATTCTATTAGAATAATGG + Intergenic
922879265 1:228968258-228968280 ATAAAGTTCTATTATATTACAGG + Intergenic
1065532563 10:26687327-26687349 ATAAAACTCTATTAGGCTATAGG + Intergenic
1069190319 10:65479375-65479397 ATAAAGTTCTTTTATACTACAGG + Intergenic
1069320034 10:67158271-67158293 AAAAAATTATATAATACTATAGG + Intronic
1071461257 10:85898877-85898899 ATAATAGGCGACTATACTATTGG - Intronic
1072573392 10:96677938-96677960 ATAAAATTGTAATATAATATTGG - Intronic
1072603002 10:96948780-96948802 ATAATATTCAATTATTATATGGG + Intronic
1074166860 10:110887597-110887619 ATAAAATTTTATTGAACTATAGG + Intronic
1074565731 10:114575999-114576021 ATAAATTTCCATTATACCAAAGG + Intronic
1075934680 10:126329423-126329445 AGAAAATTCCATCATGCTATTGG - Intronic
1078305491 11:10180885-10180907 AAAAAGTTAGATTTTACTATTGG - Intronic
1086959275 11:92966103-92966125 ATAAAATTTCATTATACTGTTGG + Intergenic
1088145043 11:106666424-106666446 TTAAAATTCCATTAAAATATGGG - Intergenic
1088738040 11:112744735-112744757 TTAAAATTAGATTCTACTAAAGG + Intergenic
1088859081 11:113783089-113783111 ATAAAGGTTGATTAAACTATTGG - Intergenic
1090737853 11:129626844-129626866 ATACAATTTGATTATAATGTGGG - Intergenic
1092782538 12:12000348-12000370 AGAAAATTAGATTATACCAAAGG + Intergenic
1093395745 12:18679994-18680016 ATAAAATTTGAGCATTCTATAGG - Intergenic
1094413478 12:30192417-30192439 ATAAGATTCATTTATACAATGGG - Intergenic
1095173967 12:39068891-39068913 ATAAAATTGGTTTAATCTATAGG - Intergenic
1095342169 12:41103516-41103538 ATAAAATCTGATTTTACTTTTGG + Intergenic
1095347109 12:41163934-41163956 ATAAATTTCCATAATACAATCGG + Intergenic
1097951891 12:65439407-65439429 AAAAAAGTTGATTGTACTATTGG - Intronic
1099080334 12:78170899-78170921 TTAAAATTACATTATACTTTGGG + Intronic
1101965408 12:109279057-109279079 ATAAAATTCTAACAGACTATCGG + Exonic
1105738451 13:23296881-23296903 ATAAAATACAAATATATTATTGG - Intronic
1106842295 13:33696861-33696883 ATAAAATTCTATTAAAGTAGAGG - Intergenic
1107639107 13:42423081-42423103 ATACAATTCTATTATTCTGTAGG - Intergenic
1109278227 13:60325597-60325619 AAAAATTTTGATTATACTCTCGG + Intergenic
1109449048 13:62484468-62484490 TTAAAATGCGATTTTTCTATTGG - Intergenic
1109938176 13:69322101-69322123 ATAAAATTATATTATTTTATTGG + Intergenic
1110792922 13:79605306-79605328 ATAAATATCGATTGTACTTTGGG + Intergenic
1110928287 13:81183295-81183317 ATAGAATATGAATATACTATGGG + Intergenic
1111727155 13:92026589-92026611 ATATAATTCAATTATAAAATAGG - Intronic
1112830931 13:103450127-103450149 ATAAAATTTGAATTTAATATGGG - Intergenic
1112982124 13:105397989-105398011 ATAAAATTGAATTATAACATTGG - Intergenic
1114789358 14:25638936-25638958 ATTAAATTCGTTATTACTATGGG - Intergenic
1115090553 14:29569062-29569084 ATGAAATTGGATTGTACTTTTGG + Intergenic
1115164733 14:30435675-30435697 ATACAATTGGATATTACTATTGG - Intergenic
1115165413 14:30443156-30443178 ATAAAAATCTCTTATAGTATTGG - Intergenic
1115351329 14:32398696-32398718 TCAAAATTCAATTATATTATTGG - Intronic
1116031817 14:39582833-39582855 ATAAAATTCTATTATTCAATAGG + Intergenic
1118493758 14:66287460-66287482 ATAAAATGAGATTGTAGTATGGG + Intergenic
1118534299 14:66742537-66742559 CTAAAAATCAATTCTACTATGGG - Intronic
1119681613 14:76596420-76596442 TTAAAATTCAATTTTACTTTGGG - Intergenic
1120678151 14:87446998-87447020 ATAAAATACGATTATTTTAATGG + Intergenic
1123203388 14:106690166-106690188 TTAAAATTGTATTATATTATTGG + Intergenic
1123538868 15:21266805-21266827 ATAAAAATCTATTATACTTATGG - Intergenic
1124417953 15:29489991-29490013 ATAAAATTCAATAATTCTATTGG + Intronic
1125078101 15:35643917-35643939 ATAAAATTATTTTTTACTATAGG - Intergenic
1126560625 15:50039931-50039953 ATAAAAATAGTTTATAATATTGG + Intronic
1129429839 15:75491614-75491636 ATAAAAGGCAATTCTACTATGGG + Intronic
1131025664 15:89139363-89139385 ATAGAATAGGATGATACTATGGG - Intronic
1135944164 16:26850768-26850790 ATAAATTTGGATTATTCTATTGG - Intergenic
1137946741 16:52740062-52740084 ATTAAATTATTTTATACTATGGG - Intergenic
1137971311 16:52987665-52987687 CTGAAATTCTATTATTCTATAGG + Intergenic
1138859476 16:60738574-60738596 ATAAAATTTGATTATAATTCAGG + Intergenic
1139034019 16:62921303-62921325 TTAAAATTTAATTATAGTATTGG - Intergenic
1141224516 16:82102286-82102308 AATAAATTCTATTATAGTATTGG + Intergenic
1144162535 17:12575021-12575043 GTAAAGTTTGCTTATACTATTGG + Intergenic
1149966943 17:61173972-61173994 TTAAAAATGGATTATAGTATTGG - Intronic
1153818608 18:8812838-8812860 ATAAAATTTGTTTATACTGTGGG + Intronic
1159208417 18:65283689-65283711 ATAAGATTAAATTATACCATTGG - Intergenic
1159330282 18:66985629-66985651 ATAAAATTGGATTATTTAATTGG + Intergenic
1159663034 18:71122996-71123018 ATTAGATTCAATTATACAATAGG + Intergenic
925750080 2:7081186-7081208 ATAAAATACGATTATTATTTTGG - Intergenic
925983560 2:9196639-9196661 ATAATATTCCATTATTTTATGGG + Intergenic
926655082 2:15394458-15394480 GTAAAATTGGATTACACTATGGG - Intronic
928924127 2:36559610-36559632 GAAACATTCGATTATACAATTGG - Intronic
930436276 2:51347656-51347678 ATAAAATTCTATTACCTTATGGG + Intergenic
931093344 2:58911394-58911416 ATAACACTCTATTATGCTATGGG - Intergenic
931653970 2:64493090-64493112 TTAAAATTCTATTATTCTACAGG + Intergenic
932065996 2:68561130-68561152 ATAAAAATCAATTTTACTTTAGG - Intronic
932107721 2:68962169-68962191 AAAAAAATCAATTTTACTATAGG - Intergenic
933339854 2:81009739-81009761 TTAAAATTCAATTATACTCTTGG + Intergenic
933857103 2:86426360-86426382 TTAAAATTCTCTTCTACTATGGG + Intergenic
935701397 2:105815360-105815382 ATAGAATTCGATTTTTCTATGGG + Intronic
937536983 2:122901502-122901524 ATATAATTTTAATATACTATTGG - Intergenic
938180020 2:129172735-129172757 AAAAAATTCAATTATAAAATGGG + Intergenic
938660266 2:133479778-133479800 ATAAATTTCGATTATTCTGTGGG - Intronic
939221898 2:139312597-139312619 ATAACAATCTATTATACTTTTGG - Intergenic
939613764 2:144339761-144339783 AAAAAATTAGATGATAATATGGG - Intergenic
939943430 2:148380224-148380246 ATAAAATTCAATTAAATTAAAGG + Intronic
940697626 2:156999428-156999450 ATAAAATTCAATTATACACAGGG + Intergenic
941156278 2:161982049-161982071 ATAAAACTCCATTTTTCTATGGG - Intronic
942076382 2:172360301-172360323 ATAAAATTGGATTTTTCTAAAGG + Intergenic
943411309 2:187552023-187552045 ATTAAATTGAATTATAATATAGG - Intronic
944693209 2:202177046-202177068 TTAAAAATCCATTTTACTATTGG - Intronic
946584191 2:221165754-221165776 ATAAAATTGGAAGATACTGTTGG - Intergenic
947021778 2:225685377-225685399 ATAAAATTCAATTATAAAAAAGG - Intergenic
947277897 2:228415502-228415524 ATAATATTCAATTATCCTAAAGG - Intergenic
947607088 2:231493458-231493480 ATAAAGTTGGATTATACTTTTGG - Intergenic
1176674960 21:9769118-9769140 ATATAATTAGATTATTCTAGAGG - Intergenic
1177697542 21:24592796-24592818 ATAAAATATGATAATAATATTGG + Intergenic
1178251518 21:31007859-31007881 ATAAAATTTGAAAATACAATGGG - Intergenic
1179343462 21:40534035-40534057 ATAAAATTCTGTTATTCCATAGG - Intronic
1180731482 22:17985611-17985633 ATAAAATTTGAATATAGAATTGG - Intronic
1181516517 22:23416836-23416858 ATAAAATTTGAATATAGAATTGG - Intergenic
951158940 3:19392087-19392109 ATAATATACAATTATATTATAGG + Intronic
955865444 3:63378205-63378227 ATAACATTCAATTATACAGTGGG + Intronic
956453530 3:69397779-69397801 CTAAAATTAGATTATAGTAACGG + Intronic
959272383 3:104229604-104229626 TTAAAATTAAATTATATTATTGG - Intergenic
959639251 3:108613517-108613539 ATAAAAATAGATAATACTAAAGG + Intronic
963487228 3:145950543-145950565 ATAAAATACAATTATGCAATAGG + Intergenic
964786403 3:160400506-160400528 ATATTATACGCTTATACTATGGG + Intronic
964799298 3:160536668-160536690 ATAAAATTTAGTTATACAATAGG + Intronic
965168640 3:165230720-165230742 ATAAGAATCTATTATACAATGGG + Intergenic
965663910 3:171071021-171071043 ATAAAATTAGATTAAAATTTGGG - Intronic
965928542 3:174013504-174013526 ATCAAATTCAATAATACAATGGG + Intronic
970935536 4:21565826-21565848 ATAAAATGGGATTAGACCATGGG + Intronic
973649945 4:52988757-52988779 ATACATTTCCATTTTACTATAGG + Intronic
974446507 4:61990470-61990492 ATAAAATTAGATTATGCTGATGG + Intronic
974465424 4:62249398-62249420 ATAAAATTCAATTAACCAATTGG + Intergenic
975771936 4:77734767-77734789 ATATAATTCTATTTTTCTATTGG + Intronic
977518617 4:98053275-98053297 ATAAAAATCAATTATATTTTTGG - Intronic
979188042 4:117823820-117823842 ATAAAAAACTAATATACTATTGG + Intergenic
980050472 4:128034376-128034398 ATAAAAATGTATTATACAATAGG + Intronic
980480944 4:133386048-133386070 ATAAAATGCGATTATTTTAAAGG + Intergenic
980700788 4:136427102-136427124 TTATAATTCTGTTATACTATGGG - Intergenic
981946070 4:150345735-150345757 ATCAAACTGCATTATACTATAGG + Intronic
981955186 4:150463719-150463741 ATAAAATTTGATTTTAATAAAGG + Intronic
983613419 4:169675226-169675248 ATAAAATTAGTTAATAGTATTGG + Intronic
986319703 5:6620122-6620144 ATAAAATTCGATCATAGAAGAGG + Exonic
987417198 5:17674873-17674895 ATCAAATGCTATGATACTATGGG + Intergenic
989237163 5:39161770-39161792 CTAAAATTAGATTATAGTACTGG - Intronic
989598142 5:43176835-43176857 ATATAATTTAATTATATTATTGG - Intronic
989652832 5:43712746-43712768 ATAAAATTAGACTATACTACAGG + Intergenic
990049477 5:51479561-51479583 ATAAAATTTATTTATACTCTAGG + Intergenic
993505818 5:88707612-88707634 ATAGAATTCCATTGAACTATTGG + Intergenic
997757630 5:136414730-136414752 ATATATTTCAATTATAGTATAGG - Intergenic
999966665 5:156817958-156817980 AAAGAATTCTATTATACTATTGG + Intergenic
1000110580 5:158104513-158104535 ATAAAATTCTATTATTCTATAGG - Intergenic
1000909938 5:167009960-167009982 AAAAAATTCAATTATATTTTGGG - Intergenic
1005626881 6:27670676-27670698 ATTATATTGTATTATACTATTGG + Intergenic
1006031872 6:31182060-31182082 AAAAAATTATATAATACTATAGG - Intergenic
1008076073 6:47147464-47147486 AAAAAATTCGATTATACCCATGG + Intergenic
1010685017 6:78844378-78844400 ATAAAATTAGATTTAACAATAGG - Intergenic
1011262456 6:85483599-85483621 AGAAAATTGGATGTTACTATTGG + Intronic
1014499867 6:122173391-122173413 CTAAAATTAGATAATACTAATGG - Intergenic
1014589068 6:123239264-123239286 ATAAAAATTGATTAAACTACAGG + Intronic
1014921689 6:127221144-127221166 ATAAAATTCCATAATAGTACAGG - Intergenic
1016175517 6:141074228-141074250 AGAAAAATCAATAATACTATAGG - Intergenic
1018775044 6:167006882-167006904 ACAGGATTCGAATATACTATTGG - Intronic
1020522699 7:9213902-9213924 ATAAAATATGATAATTCTATAGG + Intergenic
1023224553 7:37955426-37955448 ATTAAATTCAATTATAAAATGGG + Intronic
1027832349 7:83195319-83195341 ATAATTTTCAATTATAATATGGG - Intergenic
1028043009 7:86081108-86081130 ATACAATTCCATTATGCTACTGG + Intergenic
1028378451 7:90172738-90172760 ATAAAATTTTATTATAAAATAGG - Intronic
1034869453 7:154670795-154670817 AGAAAATGTGATTGTACTATGGG - Intronic
1035156337 7:156916792-156916814 ATAAAATTAAATTATAATTTAGG + Intergenic
1035421609 7:158734025-158734047 AGAAAATTCAATGATAATATTGG + Exonic
1038091827 8:24262796-24262818 AAAAAATTTGATTATTTTATGGG + Intergenic
1038194319 8:25352566-25352588 ATCTAATTCGATTTTAATATAGG - Intronic
1039533229 8:38283580-38283602 ATAAAAATAGATTATAATAAGGG + Intronic
1042151303 8:65788559-65788581 ATAAAATTAAGTTATACTTTTGG - Intronic
1042860443 8:73307929-73307951 ATAAAATTCTAGTATAGTATTGG - Intronic
1043066391 8:75576450-75576472 ATAAAATGTGATTATAATTTGGG + Intergenic
1044339347 8:91028969-91028991 ATAAAATTCGATTAATCCATGGG - Intronic
1044384770 8:91574611-91574633 AAAAAATACAATTATACAATTGG + Intergenic
1046772433 8:118129392-118129414 ATAAAATTCCATTTTCCTATTGG - Intergenic
1047638305 8:126790855-126790877 AGAAAATTGGAATAGACTATGGG - Intergenic
1048649153 8:136454878-136454900 AATAAATTCCATTATACGATTGG - Intergenic
1050070561 9:1808606-1808628 ATAAAAATCTATAATAATATTGG - Intergenic
1050139319 9:2501197-2501219 ATAAAATTCTATTATAGAGTAGG - Intergenic
1050588475 9:7138366-7138388 ATAAAATTCTATAATGGTATTGG - Intergenic
1050665560 9:7932353-7932375 ATTGAATTATATTATACTATGGG - Intergenic
1051241226 9:15058489-15058511 ATAAAATTAGTTAATAGTATTGG - Intergenic
1051401882 9:16692137-16692159 ACAGAATTCTATTATTCTATTGG + Intronic
1052131105 9:24847570-24847592 TTAAAATTCTATTATACTGAGGG - Intergenic
1052248363 9:26366308-26366330 TTACAATTCGATTAAACTTTGGG + Intergenic
1055737735 9:79350199-79350221 ATAATTTTAAATTATACTATTGG - Intergenic
1058186008 9:101855824-101855846 AAAAAATTAGAAAATACTATAGG + Intergenic
1059566643 9:115388873-115388895 AAAAAATTGGATTATAATAATGG + Intronic
1187935301 X:24330144-24330166 ATAAAATTTCTTAATACTATAGG - Intergenic
1188684069 X:33047474-33047496 ATAAAATTTGTTTGTACTACTGG + Intronic
1189676907 X:43470324-43470346 ATAAAAGTTAATTATACAATTGG + Intergenic
1193390267 X:80918380-80918402 ACAAAATTATATTATAATATGGG + Intergenic
1193766979 X:85541561-85541583 ATAATAATTGCTTATACTATGGG - Intergenic
1196401898 X:115325568-115325590 CTAAAATTAGACTATAGTATTGG - Intergenic
1196481338 X:116153394-116153416 GTATAATTCAATTATAATATGGG + Intergenic
1199920828 X:152401662-152401684 CGAAAATTCAGTTATACTATTGG + Intronic