ID: 909432484

View in Genome Browser
Species Human (GRCh38)
Location 1:75605686-75605708
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909432479_909432484 15 Left 909432479 1:75605648-75605670 CCCTAATGGGAAACTACCAAAAG 0: 1
1: 0
2: 1
3: 11
4: 229
Right 909432484 1:75605686-75605708 ATACTATGGGAATCCACAGAAGG No data
909432480_909432484 14 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432484 1:75605686-75605708 ATACTATGGGAATCCACAGAAGG No data
909432481_909432484 -1 Left 909432481 1:75605664-75605686 CCAAAAGTTATAAAATTCGATTA No data
Right 909432484 1:75605686-75605708 ATACTATGGGAATCCACAGAAGG No data
909432477_909432484 28 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432484 1:75605686-75605708 ATACTATGGGAATCCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type