ID: 909432486

View in Genome Browser
Species Human (GRCh38)
Location 1:75605688-75605710
Sequence ACTATGGGAATCCACAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909432480_909432486 16 Left 909432480 1:75605649-75605671 CCTAATGGGAAACTACCAAAAGT 0: 1
1: 0
2: 0
3: 22
4: 167
Right 909432486 1:75605688-75605710 ACTATGGGAATCCACAGAAGGGG 0: 1
1: 0
2: 2
3: 20
4: 197
909432481_909432486 1 Left 909432481 1:75605664-75605686 CCAAAAGTTATAAAATTCGATTA No data
Right 909432486 1:75605688-75605710 ACTATGGGAATCCACAGAAGGGG 0: 1
1: 0
2: 2
3: 20
4: 197
909432477_909432486 30 Left 909432477 1:75605635-75605657 CCTCTGTCATGGGCCCTAATGGG No data
Right 909432486 1:75605688-75605710 ACTATGGGAATCCACAGAAGGGG 0: 1
1: 0
2: 2
3: 20
4: 197
909432479_909432486 17 Left 909432479 1:75605648-75605670 CCCTAATGGGAAACTACCAAAAG 0: 1
1: 0
2: 1
3: 11
4: 229
Right 909432486 1:75605688-75605710 ACTATGGGAATCCACAGAAGGGG 0: 1
1: 0
2: 2
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909432486 Original CRISPR ACTATGGGAATCCACAGAAG GGG Intronic
903823124 1:26118708-26118730 ACTAAACGAATCCACAGAAAGGG - Intronic
904701461 1:32360987-32361009 ACCCTGGCAACCCACAGAAGCGG - Intronic
905019127 1:34796305-34796327 ACAATGGCAATGTACAGAAGTGG + Intronic
906272970 1:44496041-44496063 ACTACGGGAAGCTACTGAAGAGG + Intronic
907290456 1:53409316-53409338 GCTATGGGACTCCACACAGGGGG + Intergenic
908398872 1:63751524-63751546 ACTTTGGGGTTCCACAGAAGTGG - Intergenic
908719860 1:67113700-67113722 ACAATGAGAATCCGCTGAAGAGG + Intronic
909212771 1:72845434-72845456 AGTATGGGAATTCACATCAGGGG + Intergenic
909432486 1:75605688-75605710 ACTATGGGAATCCACAGAAGGGG + Intronic
910505769 1:87948864-87948886 ACTATGGGAATGCATAGAAGAGG + Intergenic
912792278 1:112663987-112664009 ACTTTGGGAAGCCAAAGCAGGGG + Intronic
913244662 1:116861056-116861078 ACTATAGGAAGCCACTTAAGAGG - Intergenic
913365491 1:118033458-118033480 ACAATGGGAATAGATAGAAGAGG - Intronic
916516765 1:165525707-165525729 GCTATGGGAGTCCAGAGAAAGGG - Intergenic
916709375 1:167389839-167389861 ACTAGTTGAATCCACAGATGTGG - Intronic
918176993 1:182055822-182055844 AATAAAGGAATCCCCAGAAGTGG - Exonic
923217468 1:231862340-231862362 ACTAAGGGAATCCTCACAATGGG - Intronic
924357085 1:243191069-243191091 GCTATGGGAAAGAACAGAAGAGG - Exonic
924953011 1:248902793-248902815 ACTATGAGAACACACAGATGGGG + Intergenic
1065338585 10:24680659-24680681 TCTATGGGCCTTCACAGAAGCGG + Intronic
1066779433 10:38927768-38927790 AACATGGGAAATCACAGAAGTGG - Intergenic
1067261484 10:44696879-44696901 TCTCTGTGAAGCCACAGAAGGGG - Intergenic
1067675210 10:48368837-48368859 ACTATGCGATACAACAGAAGAGG - Intronic
1069873318 10:71546478-71546500 GCTCTGGGAGCCCACAGAAGGGG + Intronic
1070831474 10:79420393-79420415 ACTGTGGGGATCCACAGAGGTGG - Intronic
1071559543 10:86634230-86634252 ATTAATGGAATCCAAAGAAGGGG - Intergenic
1072246359 10:93547460-93547482 GCCATGGAAACCCACAGAAGGGG - Intergenic
1072898929 10:99390532-99390554 ATTGTGGAAATCCGCAGAAGGGG + Intronic
1073794453 10:106972735-106972757 ACTATGGGAATAAAGAGAAGGGG + Intronic
1075153047 10:119952484-119952506 ACTGTGGAAATTCACAGAAATGG - Intergenic
1076330453 10:129660644-129660666 ATTATGGAAACCCACAGCAGAGG - Intronic
1078330079 11:10412059-10412081 TCCATGGGAATTCCCAGAAGAGG - Intronic
1079510718 11:21206607-21206629 ACTATGAGATTCCAAAGAAAAGG - Intronic
1080379847 11:31757209-31757231 ACTATGGAAAACCATGGAAGGGG + Intronic
1080958585 11:37130687-37130709 ACTGTGGAAAGCCACAGAGGCGG + Intergenic
1082781999 11:57294985-57295007 ACTGTGGGAAGCCCCTGAAGTGG - Intergenic
1083401598 11:62426916-62426938 GCTATGCCAATCCACAGAAATGG + Intergenic
1084857403 11:71997906-71997928 ACCATGGGAAGCCACAGCTGGGG - Intergenic
1084922235 11:72480477-72480499 ACTTTGGGAAGCCAAGGAAGGGG - Intergenic
1085009222 11:73125458-73125480 ACTTTGGGAGGCCAAAGAAGGGG + Intronic
1085476368 11:76791653-76791675 TCTCTGAGCATCCACAGAAGGGG + Intronic
1086107268 11:83158539-83158561 CCCATATGAATCCACAGAAGAGG - Intronic
1086551706 11:88059903-88059925 ACTATGAGCATCCAGAGAATTGG - Intergenic
1086873539 11:92068097-92068119 AATATGGGAAGCCTCTGAAGTGG - Intergenic
1088069145 11:105759807-105759829 GCTATGGGAATGCACAGAAGGGG - Intronic
1090023427 11:123147596-123147618 GCTATGGGAATCCAGAGTAGGGG - Intronic
1090289201 11:125527244-125527266 GCTTTGGGAATTCTCAGAAGGGG - Intergenic
1090389718 11:126381181-126381203 ACTATGAGAGACCACAGCAGGGG - Intronic
1091106968 11:132931375-132931397 AATAAGGCAATCCACAGAATGGG + Intronic
1091555723 12:1572064-1572086 ACTATGAGAAACAAGAGAAGTGG + Intronic
1095195558 12:39311485-39311507 GCTATGTGAATACACTGAAGTGG + Exonic
1095474331 12:42570483-42570505 AATTTGGAAATCCACTGAAGTGG - Intronic
1096417572 12:51426808-51426830 ACAAGGGGAAGCCACTGAAGGGG + Intronic
1097622932 12:61963628-61963650 AGTATGGCAATCTACAGAATGGG - Intronic
1099040138 12:77642526-77642548 ACTGTGGGAACACACAAAAGGGG - Intergenic
1100312083 12:93405513-93405535 AATATTGGATTCCACACAAGAGG + Exonic
1103361280 12:120355866-120355888 ACTCTGGGAATTCAGAGGAGGGG - Intronic
1105728273 13:23186828-23186850 CCTATGGGATTCCACATCAGTGG + Intronic
1105950580 13:25225947-25225969 TGTGTGGGCATCCACAGAAGGGG + Intergenic
1105965546 13:25380864-25380886 ACTTGGGGAATCCAAAGACGTGG - Intronic
1106681395 13:32012001-32012023 TCTTTTGGAACCCACAGAAGTGG + Intergenic
1108285111 13:48898947-48898969 ACTATGGGGAGGCACTGAAGGGG - Intergenic
1109506415 13:63308237-63308259 ACTTTGGGGAGCCACAGAAAAGG + Intergenic
1111511669 13:89272990-89273012 ACTAGGAGAAGCCACAGAATTGG + Intergenic
1112064702 13:95780858-95780880 ACTATGGAAATGCTGAGAAGTGG + Intronic
1114474749 14:22986233-22986255 ACTATGGCAATATACAGCAGGGG - Exonic
1115254833 14:31388764-31388786 AGTATCTGACTCCACAGAAGTGG - Intronic
1117572750 14:57064225-57064247 ACTTTGGGAATTCAAAGCAGAGG - Intergenic
1117586046 14:57205859-57205881 ACTATGGCAATCCTCAAAATGGG + Exonic
1118246309 14:64114521-64114543 ACTATGGGCTTACATAGAAGGGG - Intronic
1120110187 14:80545133-80545155 CCTATCAGACTCCACAGAAGTGG - Intronic
1121683941 14:95817649-95817671 GCTGTGGGAATTCAGAGAAGGGG - Intergenic
1122183948 14:99975085-99975107 AAAATGGGAAGCCACAGCAGTGG - Intronic
1202937829 14_KI270725v1_random:108485-108507 AACATGGGAAATCACAGAAGTGG + Intergenic
1124905366 15:33863089-33863111 GCCATGGGAAGGCACAGAAGGGG - Intronic
1125550352 15:40540173-40540195 ACTAGGGCAATCCAGAGGAGTGG + Intronic
1125810775 15:42539232-42539254 ACTATGGGAAGCCAAGGCAGGGG + Exonic
1127010098 15:54615814-54615836 TCTTTTGGAATCCACAGAATTGG - Intronic
1127608029 15:60609650-60609672 AAAATGGGAAGACACAGAAGAGG + Intronic
1131642912 15:94312021-94312043 ACTATTGGGATCCACTAAAGTGG - Intronic
1132917730 16:2362287-2362309 GCAATGGGAAGCCACTGAAGGGG - Intergenic
1135598459 16:23761365-23761387 ACTTTGGGAAGCCAAAAAAGGGG - Intergenic
1137855678 16:51792301-51792323 ATGATGGAAAGCCACAGAAGAGG + Intergenic
1139566472 16:67780440-67780462 TAAATGGGAAGCCACAGAAGGGG + Intronic
1140827876 16:78724589-78724611 ACTAGGGGACTACACATAAGTGG - Intronic
1140953905 16:79844991-79845013 AATATGGGAATCCAGAAATGGGG + Intergenic
1143672846 17:8408381-8408403 TCGATGGGAAACCACTGAAGTGG + Intergenic
1144323741 17:14156795-14156817 ATTATGGGAGTCCAGAGAACGGG - Intronic
1144582939 17:16470158-16470180 GCTAGGGGAAGCCACAGAGGAGG + Intronic
1145708739 17:26948437-26948459 AACATGGGAAATCACAGAAGTGG - Intergenic
1147913494 17:43872383-43872405 ACTATGGGACTGAACAAAAGAGG - Intergenic
1149024013 17:52003330-52003352 ATTATGGGAACCCACAGGACAGG - Intronic
1149159019 17:53668005-53668027 ACCATGGAAAGCCACAGAAGTGG + Intergenic
1149855299 17:60077840-60077862 GCTATGGGAATAGACAGGAGGGG + Intronic
1152244063 17:79176168-79176190 GCTCAGGGAATCCACAGAAGAGG - Intronic
1155435720 18:25810900-25810922 TCTATGGGAATCCAAACAAGGGG + Intergenic
1156006900 18:32452808-32452830 ACTTTGAGGATCCAGAGAAGGGG + Intronic
1156379858 18:36547946-36547968 ACTTTGGGAGGCCAAAGAAGCGG + Intronic
1156423268 18:36979494-36979516 ACTGTGGGAGTCCACAGAATAGG + Intronic
1157359605 18:46964939-46964961 TCTTTTGGAATCCACAGATGTGG - Intronic
1157361199 18:47024458-47024480 TCTTTTGGAATCCACAGATGTGG - Intronic
1157362189 18:47030373-47030395 TCTTTTGGAATCCACAGATGTGG - Intronic
1157902922 18:51537978-51538000 ACTATGGGAATACAAAGCATCGG + Intergenic
1158114948 18:53984803-53984825 ACTATGCTAATCCACTGAATAGG - Intergenic
1159929557 18:74296915-74296937 GCTATTGGACTGCACAGAAGTGG - Intergenic
1164670825 19:30071051-30071073 ATTATGGGAAACAGCAGAAGTGG + Intergenic
1168112535 19:54201613-54201635 CGTATGGGAGTCCACAGCAGAGG + Intronic
925013179 2:501490-501512 ACTGTGGGAATTCAGCGAAGGGG - Intergenic
925821232 2:7801630-7801652 ACCATGAAAAACCACAGAAGTGG + Intergenic
925938599 2:8792722-8792744 ACTATGGGCATCCACTGACTTGG + Intronic
926646380 2:15294182-15294204 GCTCTGGGAATACACAGGAGTGG + Intronic
928289861 2:30027662-30027684 ACTATGCAAATCCAGAGGAGGGG + Intergenic
929048296 2:37812351-37812373 ACTCTACGAATCCACAGAGGGGG + Intergenic
929859378 2:45663356-45663378 ACTGTGGGAATTCAAAGGAGAGG + Intronic
929923888 2:46193603-46193625 ACCAGGGAAATCCAGAGAAGGGG + Intergenic
931069144 2:58624889-58624911 ACTATGGGAACCCAAGGAAAAGG + Intergenic
931620478 2:64205064-64205086 GCTTTAGGAATCCACAGAATTGG - Intergenic
932949942 2:76281297-76281319 ACTGTGGAAATGCAGAGAAGGGG - Intergenic
933596248 2:84286153-84286175 ACAATGGGAATGGAGAGAAGAGG + Intergenic
933744331 2:85559813-85559835 ACCCTGGGAATAAACAGAAGAGG + Intronic
934517066 2:94995334-94995356 ACTATGAGAATCCACAGGCAGGG + Intergenic
936673342 2:114684900-114684922 ACCATGGAGATCCACTGAAGTGG + Intronic
939299648 2:140319187-140319209 AACATGGGATTACACAGAAGAGG + Intronic
945620868 2:212135175-212135197 ACTATTGTAATCAACAAAAGAGG - Intronic
947083940 2:226429766-226429788 ATTATGGGAATACCCAGGAGAGG - Intergenic
948037753 2:234873023-234873045 TCTGGGGGAGTCCACAGAAGAGG + Intergenic
948984114 2:241509416-241509438 ACTAGGGGAATGCACACAGGGGG - Intronic
1169891716 20:10460668-10460690 TCAATGGAAGTCCACAGAAGTGG - Intronic
1170478508 20:16741890-16741912 ACCATGGGTATCTCCAGAAGTGG + Exonic
1171077157 20:22139329-22139351 ACTATATGATTCCACATAAGTGG - Intergenic
1173477623 20:43372937-43372959 ACTGTGGACACCCACAGAAGGGG + Intergenic
1173759154 20:45544754-45544776 GCTATGGCAATCCACCGAGGCGG - Intronic
1176955089 21:15093434-15093456 ATTATAGGAAGCCACAGAATAGG + Intergenic
1181465382 22:23108010-23108032 ACCCTAGGCATCCACAGAAGTGG + Intronic
1183172167 22:36196610-36196632 ATTATGGAACTCCAGAGAAGGGG + Intronic
1183204035 22:36406094-36406116 ACCATGGGAAGCCACTGAAGGGG - Intergenic
1203290438 22_KI270735v1_random:32078-32100 AACATGGGAAATCACAGAAGTGG + Intergenic
950314795 3:11991802-11991824 GCTCTGGGAATGCAGAGAAGGGG + Intergenic
951144072 3:19205613-19205635 ACTACAGGAATACATAGAAGTGG + Intronic
952054866 3:29432151-29432173 ACAATGGGAATTCAGAGAAAAGG + Intronic
954056623 3:48031305-48031327 ACTTTGGGAAGCCAAAGTAGGGG + Intronic
954235327 3:49252667-49252689 ACTTTGGGAAGCCACTGAGGCGG - Intronic
956244979 3:67172807-67172829 ACTCTGGGAATACAGTGAAGAGG + Intergenic
956858846 3:73302663-73302685 ACTCTGAGACTCCCCAGAAGGGG + Intergenic
960589437 3:119351169-119351191 CCTAGGGGAATTCAAAGAAGAGG + Intronic
961635083 3:128328233-128328255 ACAGTGGGCACCCACAGAAGTGG + Intronic
962076381 3:132086666-132086688 AAGATTGGAATCCATAGAAGCGG - Intronic
963677391 3:148329646-148329668 AATTTGGTAAACCACAGAAGTGG - Intergenic
963872681 3:150435223-150435245 ACTTTGGGATCCCACAGAGGTGG - Intronic
967297033 3:187975409-187975431 GCTATGAGAATACACAGAATTGG + Intergenic
968909002 4:3467147-3467169 ACGATGGGAGTCCGCAGAAGTGG - Intronic
973141648 4:46776557-46776579 GCAATGGGAATTCAGAGAAGGGG + Intronic
974096503 4:57370255-57370277 ACAATGGGAATAGACAGAGGGGG - Intergenic
975076593 4:70216907-70216929 ACTATGGGAAGCCTTAGCAGTGG + Intergenic
975682665 4:76892117-76892139 ACTCTGAGAATTCAGAGAAGGGG - Intergenic
977638533 4:99328752-99328774 ATGATGGAAATTCACAGAAGAGG - Intergenic
977794629 4:101148648-101148670 ACTATCGGAATCCAAAGAGGTGG - Intronic
978247847 4:106596607-106596629 AGTATGAGAAACCAAAGAAGGGG + Intergenic
981373865 4:143991479-143991501 ACTATGCAAAGCCACAGGAGCGG - Intergenic
982944477 4:161602477-161602499 ACCATGGGAATCACCAAAAGAGG + Intronic
985839274 5:2293865-2293887 TCTGGGGGCATCCACAGAAGTGG + Intergenic
986008824 5:3693354-3693376 ACTGTCGGAATTCACAGAAGCGG - Intergenic
988104185 5:26722320-26722342 AGTGTGGGAAGCCACAGAAGAGG - Intergenic
991972373 5:72153448-72153470 AAGATGGGTATCCACAGAAATGG - Intronic
992151962 5:73913736-73913758 ACTATGGAGATCCTCAGTAGTGG - Intronic
992556829 5:77912104-77912126 ACTTTGGGAATGAACTGAAGAGG - Intergenic
993196995 5:84761883-84761905 CCTATGGGACACAACAGAAGCGG - Intergenic
998942614 5:147301046-147301068 AATATGGAAATTCACAGAAAGGG + Intronic
1001396644 5:171422863-171422885 ACTCTGGGGATCCACAGAGAGGG - Intronic
1002086082 5:176776482-176776504 ACTCAGGGCAGCCACAGAAGAGG - Intergenic
1005597678 6:27394762-27394784 ACTCTGCAAAGCCACAGAAGTGG + Intronic
1006024684 6:31139377-31139399 ACTATTGGAAGCCAAAGAATGGG + Intronic
1009477802 6:64115522-64115544 ACTATGAGTATCCACAGTAGTGG - Intronic
1010515992 6:76772970-76772992 TCTATGGGATTCCACAGAGGTGG + Intergenic
1012065060 6:94539181-94539203 ATTAAGGGAATCAACAAAAGCGG + Intergenic
1012272198 6:97227293-97227315 AGTATGGGCATCTTCAGAAGAGG - Intronic
1013730798 6:113164423-113164445 ACTTTGGGAAGCCAAAGCAGTGG + Intergenic
1014196511 6:118566133-118566155 ACATTGGGAAACCACAGTAGGGG - Exonic
1014324560 6:119976422-119976444 ACTATGGGACCCTAGAGAAGTGG + Intergenic
1015147383 6:130002549-130002571 ACTTTGGGAAGCCAAAGCAGGGG - Intergenic
1020204329 7:6103807-6103829 ACTTTGGGAAGCCACGGAGGGGG + Intergenic
1020527813 7:9286195-9286217 ACTATGGGAATGCAGGGATGGGG + Intergenic
1021177756 7:17469635-17469657 ACTATGAGAATCCATAGATGGGG - Intergenic
1022538750 7:31115914-31115936 ACTTTGGGGATCCAACGAAGGGG - Intergenic
1023244683 7:38188532-38188554 ACCATGGGAGTGCTCAGAAGGGG + Intronic
1028677016 7:93476892-93476914 ACAATGGGAATTCCCAGAAGTGG + Intronic
1028750916 7:94381903-94381925 GCTATGGGAATACAAAGCAGAGG - Intergenic
1030117007 7:106069739-106069761 ACTATGGGAGCCCATAGAATGGG + Intergenic
1030687527 7:112502608-112502630 GCTCTGGGAATCCAGAGAAAGGG + Intergenic
1031389703 7:121199044-121199066 ACTATTGAAATTCACAGAAATGG + Intronic
1031450922 7:121916862-121916884 ACTTTGGGGATTCACAGAATGGG + Intronic
1032500106 7:132393714-132393736 ATGGTGGGAATCCACAGAAGAGG + Intronic
1035352447 7:158256192-158256214 CCTATGGGAGACAACAGAAGAGG - Intronic
1039398108 8:37244657-37244679 ACCATGTGATTCCACAGAATAGG - Intergenic
1041306239 8:56464251-56464273 ACTATAGGAATCCAAAGGAGTGG + Intergenic
1041527578 8:58824340-58824362 ACAAAGGGAAGCCACAGAATGGG - Intronic
1043549662 8:81356303-81356325 ACTTTGGGAAGCCAAGGAAGTGG + Intergenic
1044828766 8:96224545-96224567 AGAATGAGAAGCCACAGAAGGGG + Intergenic
1045327703 8:101128886-101128908 ACTTTGGGAACCCAGAGAGGTGG - Intergenic
1046001471 8:108425463-108425485 ACTTTGGGAAGCCAAAGCAGAGG - Intronic
1046084291 8:109412569-109412591 ATTTTGAGAATCCTCAGAAGAGG - Intronic
1046552872 8:115738768-115738790 ACTATGGCAACCCAAAGGAGGGG - Intronic
1047467538 8:125132328-125132350 ACTTTGGGAGGCCAAAGAAGTGG - Intronic
1049059839 8:140268026-140268048 CATATGGGAACCCAAAGAAGGGG + Intronic
1053289323 9:36869608-36869630 ACTCTGGGAACACAGAGAAGGGG - Intronic
1053446529 9:38157381-38157403 ATTGTGGGAAGCCATAGAAGTGG - Intergenic
1055188815 9:73492452-73492474 ACCATAGGAATTAACAGAAGAGG - Intergenic
1056132852 9:83602742-83602764 TCTCATGGAATCCACAGAAGAGG + Intergenic
1058285811 9:103176702-103176724 ACTTTGGGAAGCCAAAGCAGGGG + Intergenic
1058315059 9:103554598-103554620 CCTGTGGGCATTCACAGAAGTGG - Intergenic
1059282445 9:113146614-113146636 ACTATGTGATTCCACTTAAGAGG + Intergenic
1060733228 9:126050764-126050786 ACCCTCGGGATCCACAGAAGGGG + Intergenic
1186937927 X:14471789-14471811 ACTATAGAAATCCCCAGAATCGG + Intergenic
1187258453 X:17662180-17662202 ACTGTGGGCACACACAGAAGTGG + Intronic
1189615242 X:42776508-42776530 ACTATTTGAATGCAAAGAAGTGG - Intergenic
1189865669 X:45324481-45324503 ACTAATGGAATCCAGAGAAGTGG + Intergenic
1190566403 X:51734327-51734349 ATTTTGGGAATCTTCAGAAGTGG + Intergenic
1191140004 X:57106838-57106860 GTTATGGAAATCCGCAGAAGAGG + Intergenic
1192429654 X:71103404-71103426 ATGATGGGAACCCACAGCAGGGG - Exonic
1200404598 Y:2796989-2797011 ACTGAGGGATTACACAGAAGCGG + Intergenic