ID: 909434230

View in Genome Browser
Species Human (GRCh38)
Location 1:75621761-75621783
Sequence TCACCTCAGCTGAGGTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909434228_909434230 21 Left 909434228 1:75621717-75621739 CCACATTGTATTTTAAATTTTTA No data
Right 909434230 1:75621761-75621783 TCACCTCAGCTGAGGTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909434230 Original CRISPR TCACCTCAGCTGAGGTTTTT AGG Intergenic
No off target data available for this crispr