ID: 909438294

View in Genome Browser
Species Human (GRCh38)
Location 1:75669510-75669532
Sequence CACTACTGTCCCAACTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909438290_909438294 16 Left 909438290 1:75669471-75669493 CCCAGTGGAGGACACAAATAAGA No data
Right 909438294 1:75669510-75669532 CACTACTGTCCCAACTTAGGAGG No data
909438291_909438294 15 Left 909438291 1:75669472-75669494 CCAGTGGAGGACACAAATAAGAT No data
Right 909438294 1:75669510-75669532 CACTACTGTCCCAACTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909438294 Original CRISPR CACTACTGTCCCAACTTAGG AGG Intergenic
No off target data available for this crispr