ID: 909440705

View in Genome Browser
Species Human (GRCh38)
Location 1:75692481-75692503
Sequence CACCGCAGCCGGCCCGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909440694_909440705 18 Left 909440694 1:75692440-75692462 CCGCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 909440705 1:75692481-75692503 CACCGCAGCCGGCCCGAGGATGG No data
909440693_909440705 19 Left 909440693 1:75692439-75692461 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 909440705 1:75692481-75692503 CACCGCAGCCGGCCCGAGGATGG No data
909440701_909440705 5 Left 909440701 1:75692453-75692475 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 909440705 1:75692481-75692503 CACCGCAGCCGGCCCGAGGATGG No data
909440700_909440705 6 Left 909440700 1:75692452-75692474 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 909440705 1:75692481-75692503 CACCGCAGCCGGCCCGAGGATGG No data
909440696_909440705 15 Left 909440696 1:75692443-75692465 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 909440705 1:75692481-75692503 CACCGCAGCCGGCCCGAGGATGG No data
909440698_909440705 9 Left 909440698 1:75692449-75692471 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 909440705 1:75692481-75692503 CACCGCAGCCGGCCCGAGGATGG No data
909440692_909440705 22 Left 909440692 1:75692436-75692458 CCGCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 909440705 1:75692481-75692503 CACCGCAGCCGGCCCGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909440705 Original CRISPR CACCGCAGCCGGCCCGAGGA TGG Intergenic
No off target data available for this crispr