ID: 909442393

View in Genome Browser
Species Human (GRCh38)
Location 1:75712161-75712183
Sequence GTACACTACATGGTAAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909442389_909442393 14 Left 909442389 1:75712124-75712146 CCTAACTTGTTTCTCTCTGTTTT No data
Right 909442393 1:75712161-75712183 GTACACTACATGGTAAAGACTGG No data
909442388_909442393 15 Left 909442388 1:75712123-75712145 CCCTAACTTGTTTCTCTCTGTTT No data
Right 909442393 1:75712161-75712183 GTACACTACATGGTAAAGACTGG No data
909442387_909442393 16 Left 909442387 1:75712122-75712144 CCCCTAACTTGTTTCTCTCTGTT No data
Right 909442393 1:75712161-75712183 GTACACTACATGGTAAAGACTGG No data
909442386_909442393 26 Left 909442386 1:75712112-75712134 CCTACTCTTGCCCCTAACTTGTT No data
Right 909442393 1:75712161-75712183 GTACACTACATGGTAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909442393 Original CRISPR GTACACTACATGGTAAAGAC TGG Intergenic
No off target data available for this crispr