ID: 909443169

View in Genome Browser
Species Human (GRCh38)
Location 1:75720341-75720363
Sequence CTGCTTACCTTGAAATAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909443166_909443169 9 Left 909443166 1:75720309-75720331 CCTTAGACTTTGGAGCGTAGGTC No data
Right 909443169 1:75720341-75720363 CTGCTTACCTTGAAATAGATGGG No data
909443163_909443169 20 Left 909443163 1:75720298-75720320 CCTCTCAGCTTCCTTAGACTTTG 0: 2
1: 29
2: 80
3: 118
4: 335
Right 909443169 1:75720341-75720363 CTGCTTACCTTGAAATAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909443169 Original CRISPR CTGCTTACCTTGAAATAGAT GGG Intergenic
No off target data available for this crispr