ID: 909443169 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:75720341-75720363 |
| Sequence | CTGCTTACCTTGAAATAGAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909443166_909443169 | 9 | Left | 909443166 | 1:75720309-75720331 | CCTTAGACTTTGGAGCGTAGGTC | No data | ||
| Right | 909443169 | 1:75720341-75720363 | CTGCTTACCTTGAAATAGATGGG | No data | ||||
| 909443163_909443169 | 20 | Left | 909443163 | 1:75720298-75720320 | CCTCTCAGCTTCCTTAGACTTTG | 0: 2 1: 29 2: 80 3: 118 4: 335 |
||
| Right | 909443169 | 1:75720341-75720363 | CTGCTTACCTTGAAATAGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909443169 | Original CRISPR | CTGCTTACCTTGAAATAGAT GGG | Intergenic | ||
| No off target data available for this crispr | |||||