ID: 909445217 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:75742145-75742167 |
| Sequence | CTGGGGGTGGGGAGGGGGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 17283 | |||
| Summary | {0: 2, 1: 17, 2: 154, 3: 1778, 4: 15332} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909445217_909445233 | 8 | Left | 909445217 | 1:75742145-75742167 | CCTTCCCCCCTCCCCACCCCCAG | 0: 2 1: 17 2: 154 3: 1778 4: 15332 |
||
| Right | 909445233 | 1:75742176-75742198 | TCTTGGCTCAAGATACAAAAAGG | No data | ||||
| 909445217_909445227 | -9 | Left | 909445217 | 1:75742145-75742167 | CCTTCCCCCCTCCCCACCCCCAG | 0: 2 1: 17 2: 154 3: 1778 4: 15332 |
||
| Right | 909445227 | 1:75742159-75742181 | CACCCCCAGGCCTCACTTCTTGG | 0: 2 1: 0 2: 0 3: 22 4: 339 |
||||
| 909445217_909445234 | 21 | Left | 909445217 | 1:75742145-75742167 | CCTTCCCCCCTCCCCACCCCCAG | 0: 2 1: 17 2: 154 3: 1778 4: 15332 |
||
| Right | 909445234 | 1:75742189-75742211 | TACAAAAAGGCACTCTCTACTGG | 0: 1 1: 1 2: 0 3: 6 4: 114 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909445217 | Original CRISPR | CTGGGGGTGGGGAGGGGGGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||