ID: 909445217

View in Genome Browser
Species Human (GRCh38)
Location 1:75742145-75742167
Sequence CTGGGGGTGGGGAGGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17283
Summary {0: 2, 1: 17, 2: 154, 3: 1778, 4: 15332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909445217_909445233 8 Left 909445217 1:75742145-75742167 CCTTCCCCCCTCCCCACCCCCAG 0: 2
1: 17
2: 154
3: 1778
4: 15332
Right 909445233 1:75742176-75742198 TCTTGGCTCAAGATACAAAAAGG No data
909445217_909445227 -9 Left 909445217 1:75742145-75742167 CCTTCCCCCCTCCCCACCCCCAG 0: 2
1: 17
2: 154
3: 1778
4: 15332
Right 909445227 1:75742159-75742181 CACCCCCAGGCCTCACTTCTTGG 0: 2
1: 0
2: 0
3: 22
4: 339
909445217_909445234 21 Left 909445217 1:75742145-75742167 CCTTCCCCCCTCCCCACCCCCAG 0: 2
1: 17
2: 154
3: 1778
4: 15332
Right 909445234 1:75742189-75742211 TACAAAAAGGCACTCTCTACTGG 0: 1
1: 1
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909445217 Original CRISPR CTGGGGGTGGGGAGGGGGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr