ID: 909447286

View in Genome Browser
Species Human (GRCh38)
Location 1:75761194-75761216
Sequence GCAGCTTGGGAGGTTGATTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13368
Summary {0: 1, 1: 0, 2: 5, 3: 365, 4: 12997}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909447286 Original CRISPR GCAGCTTGGGAGGTTGATTC TGG Exonic
Too many off-targets to display for this crispr