ID: 909453412

View in Genome Browser
Species Human (GRCh38)
Location 1:75823787-75823809
Sequence ATGAGTTCATGACCTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909453412_909453415 7 Left 909453412 1:75823787-75823809 CCCTGCAGAGGTCATGAACTCAT No data
Right 909453415 1:75823817-75823839 AATGGCTGCATAGTATTCCATGG 0: 392
1: 25685
2: 13905
3: 8104
4: 5431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909453412 Original CRISPR ATGAGTTCATGACCTCTGCA GGG (reversed) Intronic
No off target data available for this crispr