ID: 909458930

View in Genome Browser
Species Human (GRCh38)
Location 1:75885411-75885433
Sequence CTCAGGATACCAACTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909458930 Original CRISPR CTCAGGATACCAACTGAGGT GGG (reversed) Intronic
900685012 1:3942750-3942772 TTCAGGAAACCAACAGAGATGGG + Intergenic
902109523 1:14066641-14066663 CTCTGGAAACCAACAGAGGGCGG - Intergenic
902291192 1:15436333-15436355 CTCAGGAGACTAAGTAAGGTAGG + Intergenic
902691696 1:18113768-18113790 CTCAGGAAACCAACAAAGGACGG - Intronic
905687879 1:39921880-39921902 CTGAGGATATGAACCGAGGTGGG - Intergenic
909352767 1:74673706-74673728 CTGTGGATACCAACGGAGGGTGG - Exonic
909458691 1:75882432-75882454 CTATGGATACCACCTGAAGTGGG - Intronic
909458930 1:75885411-75885433 CTCAGGATACCAACTGAGGTGGG - Intronic
913998151 1:143668111-143668133 CTCAGGGTGTCAACAGAGGTAGG + Intergenic
914508633 1:148310463-148310485 CTCAGGTTGTCAACAGAGGTAGG + Intergenic
918600759 1:186357154-186357176 CTCAGGAGACAGGCTGAGGTGGG - Intronic
920871770 1:209800996-209801018 CAAAGGATACCAGCTGGGGTTGG - Intronic
923511234 1:234655616-234655638 CTCAGATTTCCACCTGAGGTTGG + Intergenic
924638291 1:245809395-245809417 CTGTGGGTCCCAACTGAGGTGGG - Intronic
1065763601 10:29006514-29006536 CTCTGGTTACCAACTAAGGGAGG - Intergenic
1066108683 10:32177741-32177763 CTGAAGTTACAAACTGAGGTTGG + Intergenic
1072553308 10:96495219-96495241 CTCAGGAAACAGGCTGAGGTGGG + Intronic
1075364736 10:121875647-121875669 CACAGGATACCACCTGGGGAAGG - Intronic
1082641250 11:55664170-55664192 CTCATGATACCACATGAGGTAGG - Intergenic
1085805133 11:79629083-79629105 ATCAGGATCCAAACCGAGGTTGG + Intergenic
1088454878 11:110023190-110023212 CTAAAAATACAAACTGAGGTGGG + Intergenic
1089871619 11:121678439-121678461 CTACGGAAACCATCTGAGGTGGG + Intergenic
1090391261 11:126389674-126389696 CTCAGGAGGCTAACTAAGGTGGG - Intronic
1097748634 12:63327832-63327854 CTCAGGATCCTAACAGATGTTGG - Intergenic
1100393178 12:94162144-94162166 TTCAGAATAAAAACTGAGGTAGG + Intronic
1108595165 13:51943136-51943158 CTCAGGAGAACAACAGAAGTGGG - Intronic
1110759568 13:79216615-79216637 TTCTGGATACCAATTGAGGGTGG + Intergenic
1111511940 13:89278024-89278046 GTCAGGAGCCCAGCTGAGGTGGG + Intergenic
1113038138 13:106073876-106073898 CTAAGGAAACCAACTGATATTGG + Intergenic
1114355693 14:21905585-21905607 CTCAGGAAGCTGACTGAGGTGGG - Intergenic
1117672737 14:58124734-58124756 ATCAGTATACAAGCTGAGGTTGG - Intronic
1126696246 15:51328512-51328534 CTCAGGATTCCCAGTGAGGGTGG - Intronic
1132227420 15:100153289-100153311 TTCAGGATTTCAACTGGGGTGGG + Intronic
1133277037 16:4645272-4645294 CTCAGGACACTCACTGAGGCAGG - Intronic
1133942513 16:10322183-10322205 CTGAGGATAACAAATGTGGTTGG - Intergenic
1138286368 16:55813169-55813191 CTCAGGATCCTAACTTAGGGGGG + Intronic
1144153234 17:12471555-12471577 CTAAGAATACCATTTGAGGTAGG - Intergenic
1146115395 17:30133049-30133071 CTCAGGAGGCTGACTGAGGTGGG - Intronic
1146915313 17:36674552-36674574 CTCAGGATCTCTCCTGAGGTTGG - Intergenic
1147177800 17:38667296-38667318 CTCAGGACACAACATGAGGTAGG - Intergenic
1149281533 17:55110519-55110541 CAGAGGCTAACAACTGAGGTGGG + Intronic
1150242419 17:63645780-63645802 CACAGCATAGCAACTGAGCTGGG + Intronic
1151049541 17:70961559-70961581 CTGAGTATACCAACTGGGGTTGG - Intergenic
1151653374 17:75483919-75483941 CTCTGGAAACCTACAGAGGTTGG + Intronic
1153675840 18:7455075-7455097 CTCAGGATTCCAAGGTAGGTGGG - Intergenic
1157137334 18:45069472-45069494 CTCAGGAGACGAGCTGAGGTAGG - Intergenic
1158108272 18:53909836-53909858 CCCAGGATAAGATCTGAGGTAGG + Intergenic
1159214320 18:65370765-65370787 TTCAGGACACTACCTGAGGTAGG + Intergenic
1163438683 19:17310531-17310553 CTCAGGATGCCAACTAATGGGGG - Intronic
1168117863 19:54234299-54234321 CTGAGGAAACCAGCTGAGCTTGG + Intronic
925429398 2:3778146-3778168 CTCAGGAAACCCACTGATGGAGG - Intronic
928091814 2:28379153-28379175 CACAGGAAACCAAGAGAGGTAGG - Intergenic
929787323 2:45002069-45002091 CTCAAGATACCATTTGGGGTAGG + Intergenic
937895846 2:126976442-126976464 CTCAGAATTTCAGCTGAGGTTGG - Intergenic
938389763 2:130895512-130895534 CTGAGGATACCAAGTGAGGCAGG - Intronic
938724887 2:134098697-134098719 TTCATGATACCAGCTCAGGTGGG + Intergenic
938753990 2:134362993-134363015 CTCAGGAAATCAACTCAGGAGGG - Intronic
938987504 2:136592806-136592828 TTCAGTATACCAACTTGGGTGGG + Intergenic
940331146 2:152476119-152476141 CTCAGGATACCATCTGAGACAGG - Intronic
943770594 2:191712323-191712345 TTCAGGACACCAACTGAGGATGG + Intergenic
944559819 2:200924991-200925013 CTCAGGTGACCCACTGAGCTCGG + Intronic
1172840064 20:37897455-37897477 GTGAGGATTCCAACAGAGGTGGG - Intergenic
1173314277 20:41929743-41929765 CTCAGGATCCCTACTGGGATTGG + Intergenic
1174977420 20:55350818-55350840 ATCAGTATACAAGCTGAGGTTGG - Intergenic
1180009071 21:45037954-45037976 TTCAGGAGACAAACTAAGGTGGG + Intergenic
1183115333 22:35687663-35687685 CTCAGGAAACCAAGGGAGATAGG - Intergenic
1183817889 22:40318953-40318975 CTCAGCTTCCCGACTGAGGTGGG - Intronic
1183863997 22:40689971-40689993 CTCAGGATTAGATCTGAGGTTGG - Intergenic
952161729 3:30700678-30700700 CTCAGATTACAAACTCAGGTGGG + Intergenic
954964849 3:54601313-54601335 CTCAGGAGACTGACTGAGGTAGG - Intronic
955886090 3:63600370-63600392 CTCTGGATACCAGCTGGGTTTGG + Intronic
961991665 3:131198258-131198280 ATCAGTATACAAGCTGAGGTCGG + Intronic
962495760 3:135937498-135937520 ATCAGTATACAAGCTGAGGTCGG - Intergenic
965907375 3:173725723-173725745 CTCAGGATTCCACCAGATGTTGG + Intronic
970794316 4:19893068-19893090 CTCAGCATGCCAACTGCAGTGGG + Intergenic
973845710 4:54910951-54910973 CTCAGGCTACCAACTGATGGGGG + Intergenic
976784438 4:88802067-88802089 CTCAGCTGAGCAACTGAGGTAGG + Intronic
977673562 4:99723150-99723172 CTCAGGCTACCATTCGAGGTGGG - Intergenic
990788292 5:59448238-59448260 CTCTGGCTGCCAAGTGAGGTGGG + Intronic
992969944 5:82046100-82046122 CACAGGAGAACAGCTGAGGTAGG - Intronic
998452871 5:142248279-142248301 CTCAGTATAAGCACTGAGGTTGG + Intergenic
1000409584 5:160924111-160924133 CTCAGGAAAACAAGTGAGGCAGG + Intergenic
1004045183 6:12016872-12016894 CCAAGGGTACCAGCTGAGGTGGG + Intronic
1007985449 6:46203195-46203217 GTCAGGAATCCAACTGAGCTGGG - Intergenic
1008226225 6:48920174-48920196 CTCAGGATACAAGCTGATGCTGG - Intergenic
1011077091 6:83448994-83449016 GTCAGTATACAAGCTGAGGTCGG - Intergenic
1017829737 6:158115550-158115572 CTCAGGATTGCCTCTGAGGTGGG - Intronic
1025195328 7:56928033-56928055 CTGAGGATGTCAACTGAGGAGGG - Intergenic
1025676624 7:63648910-63648932 CTGAGGATGTCAACTGAGGAGGG + Intergenic
1025935312 7:66031214-66031236 CTTGGGATCCCAACTGAGGTAGG - Intergenic
1029127066 7:98301829-98301851 CTGAGAATACCAGCTCAGGTGGG + Intronic
1031708354 7:125011738-125011760 GTCAGGAAACCAAGTGAGGGAGG - Intergenic
1037459903 8:19098378-19098400 CTGGGGATGCCAACTGAGGGTGG + Intergenic
1037560106 8:20065895-20065917 CTCAGAATACCAATTGGTGTTGG + Intergenic
1041219306 8:55633189-55633211 CTCATGACACCCTCTGAGGTGGG - Intergenic
1043513294 8:80970987-80971009 ACCAGGAGACAAACTGAGGTGGG + Exonic
1048700712 8:137085769-137085791 ATCAAGATACTAACTGTGGTGGG + Intergenic
1050608240 9:7323947-7323969 TTCAGGATGCCAACTCAGATGGG - Intergenic
1051366726 9:16326596-16326618 CTCCAGAGACCAGCTGAGGTAGG - Intergenic
1060600333 9:124873087-124873109 GTCAGGATTGCAACTGAGGTTGG + Intronic
1187218607 X:17301276-17301298 CTCAGGAAACTAGTTGAGGTAGG + Intergenic
1187376565 X:18760717-18760739 CTCAGGAGGCTGACTGAGGTGGG - Intronic
1190202011 X:48369891-48369913 CTCAAGATACCAACTGAGATAGG - Intergenic
1190208527 X:48425522-48425544 CTCAAGATACCAACTGAGATAGG + Intergenic
1190668859 X:52720501-52720523 CTCAAGATACCAACTGAGATAGG - Intergenic
1190670558 X:52737903-52737925 CTCAAGATACCAACTGAGATAGG + Intergenic
1192848604 X:74930350-74930372 TTCAGGATACCAAAGGAGTTTGG + Intergenic
1196186067 X:112746360-112746382 CTCACAATACCAACTCAAGTTGG + Intergenic
1196976407 X:121162459-121162481 TTCAGGATATCAACTGATGTTGG + Intergenic
1199484533 X:148333551-148333573 CCCAAGATAGCAACAGAGGTTGG - Intergenic