ID: 909459456 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:75893422-75893444 |
| Sequence | AGTTGGAATAGGAATGTGTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909459446_909459456 | 22 | Left | 909459446 | 1:75893377-75893399 | CCTGTTAAAGTGAGGGCATTAGT | 0: 1 1: 1 2: 5 3: 9 4: 98 |
||
| Right | 909459456 | 1:75893422-75893444 | AGTTGGAATAGGAATGTGTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909459456 | Original CRISPR | AGTTGGAATAGGAATGTGTA GGG | Intronic | ||
| No off target data available for this crispr | |||||