ID: 909459456

View in Genome Browser
Species Human (GRCh38)
Location 1:75893422-75893444
Sequence AGTTGGAATAGGAATGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909459446_909459456 22 Left 909459446 1:75893377-75893399 CCTGTTAAAGTGAGGGCATTAGT 0: 1
1: 1
2: 5
3: 9
4: 98
Right 909459456 1:75893422-75893444 AGTTGGAATAGGAATGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909459456 Original CRISPR AGTTGGAATAGGAATGTGTA GGG Intronic
No off target data available for this crispr