ID: 909462883

View in Genome Browser
Species Human (GRCh38)
Location 1:75939303-75939325
Sequence CTTTTTTTCTAGGAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909462883_909462888 8 Left 909462883 1:75939303-75939325 CCTTCCATCTCCTAGAAAAAAAG No data
Right 909462888 1:75939334-75939356 ATTTATTAATAATTCAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909462883 Original CRISPR CTTTTTTTCTAGGAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr