ID: 909464946

View in Genome Browser
Species Human (GRCh38)
Location 1:75963110-75963132
Sequence TCTCATTTTCTATCTAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909464944_909464946 -9 Left 909464944 1:75963096-75963118 CCAGCCTGCTTGTTTCTCATTTT No data
Right 909464946 1:75963110-75963132 TCTCATTTTCTATCTAACACAGG No data
909464943_909464946 5 Left 909464943 1:75963082-75963104 CCTAGACATTAAGGCCAGCCTGC No data
Right 909464946 1:75963110-75963132 TCTCATTTTCTATCTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909464946 Original CRISPR TCTCATTTTCTATCTAACAC AGG Intergenic
No off target data available for this crispr