ID: 909465971

View in Genome Browser
Species Human (GRCh38)
Location 1:75974418-75974440
Sequence TTGGAGCCACCCATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909465971_909465976 14 Left 909465971 1:75974418-75974440 CCTTCCTCCATGGGTGGCTCCAA No data
Right 909465976 1:75974455-75974477 CAAGTATATAGCAAAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909465971 Original CRISPR TTGGAGCCACCCATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr