ID: 909475501

View in Genome Browser
Species Human (GRCh38)
Location 1:76076575-76076597
Sequence CTGTGGGAATGAAATAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909475495_909475501 30 Left 909475495 1:76076522-76076544 CCTTAGTTTCTTCAATATAAGAT 0: 1
1: 0
2: 5
3: 38
4: 432
Right 909475501 1:76076575-76076597 CTGTGGGAATGAAATAAGATAGG 0: 1
1: 0
2: 3
3: 22
4: 296
909475498_909475501 -6 Left 909475498 1:76076558-76076580 CCTGCTTCACAAGGTTGCTGTGG 0: 1
1: 1
2: 7
3: 87
4: 563
Right 909475501 1:76076575-76076597 CTGTGGGAATGAAATAAGATAGG 0: 1
1: 0
2: 3
3: 22
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909475501 Original CRISPR CTGTGGGAATGAAATAAGAT AGG Intronic
900018388 1:170359-170381 CTGTGGGTATGATAAAGGATGGG + Intergenic
900070873 1:770778-770800 CTGTGGGTATGATAAAGGATGGG + Intergenic
901146388 1:7067711-7067733 CTGTCGGCAAGAAATAAGACGGG - Intronic
902055878 1:13600052-13600074 CTGTGGTCATTAAATAAGACTGG + Intronic
902610577 1:17594841-17594863 TGGTGGGGATGAAATGAGATGGG + Intronic
903632344 1:24785329-24785351 TTGTGGGGATCAAATAAGTTAGG - Intronic
903961009 1:27057763-27057785 CACTGGGATTGAAATAAGGTTGG + Intergenic
905131888 1:35767413-35767435 CTGTATGAATAAAACAAGATTGG + Intronic
905582469 1:39092717-39092739 GTGTATGAATGAAATAAAATTGG - Intronic
906860246 1:49351561-49351583 AGGTGGGAATGAGATGAGATTGG + Intronic
907457351 1:54584191-54584213 CTTTGGGGATGAAATCAGAGCGG + Intronic
908132427 1:61087397-61087419 CTATGGGAATGAAACAAAAAGGG - Intronic
908816595 1:68041822-68041844 CTGTGGGAATGGAGAAAGACAGG - Intergenic
909475501 1:76076575-76076597 CTGTGGGAATGAAATAAGATAGG + Intronic
914680619 1:149936083-149936105 GTGAGGGCATGAAACAAGATTGG + Intronic
915452382 1:156015195-156015217 CTGCAGGAATGAAAAAATATAGG + Intronic
915648410 1:157290186-157290208 CTGAGCAAATGAAATAAGAAGGG + Intergenic
915662261 1:157414325-157414347 CTGAGCAAATGAAATAAGAAGGG - Intergenic
916550656 1:165846813-165846835 CAGTGGGAATAAAATGAGAGAGG + Intronic
916659595 1:166909562-166909584 CTGAGGGAATGAGAAAAGCTAGG + Exonic
919888449 1:201952328-201952350 CTGTTGGAATTAAATGAGCTGGG + Intergenic
920381783 1:205538892-205538914 GTGTGGGAATGAACTAATCTGGG + Intergenic
920878839 1:209861626-209861648 CTGTGGGAAGGAAGTTAGAGAGG - Intergenic
921747904 1:218758507-218758529 ATGTGGGAATAAAGTAAGAAGGG + Intergenic
922097985 1:222458850-222458872 ATGTGAGAAGGAAATAAGATTGG + Intergenic
922106239 1:222516224-222516246 CTGTGGGTATGATAAAGGATGGG + Intergenic
922254160 1:223877728-223877750 GGGTGTAAATGAAATAAGATTGG + Intergenic
922940791 1:229463677-229463699 CTGTGGGAATGAGAAAAGATGGG + Intronic
924348419 1:243093789-243093811 CTGTGGGTATGATAAAGGATGGG + Intergenic
1063628521 10:7713334-7713356 CTGTGGGAAGGAAGTAGGAGAGG - Intronic
1064631258 10:17314476-17314498 CTTTGAGAAAGAATTAAGATTGG + Intergenic
1066013927 10:31218727-31218749 CTGTGGGAGTGCAATAATAAAGG + Intergenic
1066440612 10:35435335-35435357 TTGTGAAATTGAAATAAGATAGG + Intronic
1066727941 10:38411112-38411134 CTGTGGGTATGATAAAGGATGGG - Intergenic
1068716657 10:60196305-60196327 TTGAGGAAATGAAATTAGATTGG + Intronic
1068754153 10:60631709-60631731 GTGTGATAATGAAATAACATAGG + Intronic
1070238041 10:74650904-74650926 TTCTGAGAATGAAAGAAGATGGG - Intronic
1070359877 10:75677305-75677327 CTGAGGAAATTAAATCAGATGGG - Intronic
1070382633 10:75894681-75894703 ATGTGAGAATGCCATAAGATGGG + Intronic
1070539544 10:77406309-77406331 CTGTGGGACCTCAATAAGATGGG + Intronic
1071280114 10:84094166-84094188 GTGTGAGAATGAACTAATATAGG - Intergenic
1072692997 10:97583917-97583939 CTTTGGGAATGAAGGAAGACTGG + Intergenic
1073383961 10:103106998-103107020 CTGTGGGAATGAAAGAATAAAGG - Intronic
1074061010 10:109965567-109965589 CTGTGGGAATGAAACCATAGAGG + Intergenic
1075286274 10:121189346-121189368 CTCGTGGAATGAAATGAGATGGG - Intergenic
1076974991 11:165555-165577 CTGTGGGTATGATAAAGGATGGG + Intergenic
1078597983 11:12705054-12705076 CTCTGGGAAGGAAAGAAGAATGG + Intronic
1080021142 11:27561467-27561489 AGGTGGGAATGAACAAAGATAGG - Intergenic
1080579533 11:33631010-33631032 CTGTGGCAATGAACTTGGATGGG + Intronic
1082085277 11:48044890-48044912 CTGAGTGAATGAAAGAATATTGG + Intronic
1082188621 11:49214919-49214941 CTGTGGGAAAAAAATATTATAGG + Intergenic
1082775719 11:57242976-57242998 CTGAGTGAATGAATTAGGATGGG - Intergenic
1083360633 11:62104960-62104982 GTGTGGGAATGAACTAATACAGG + Intergenic
1083492373 11:63022417-63022439 CTGTGGGCAGGAAATAAGGCAGG - Intergenic
1083598765 11:63933294-63933316 TTGTGAGAATTAAATAAGATGGG - Intergenic
1085667386 11:78426716-78426738 CTAGGGGAAAGAAACAAGATTGG - Intergenic
1087175624 11:95092460-95092482 CTGTGGAGATTAAAGAAGATGGG + Intronic
1090763868 11:129860227-129860249 TTGTGAGAATCAAATGAGATAGG - Intergenic
1091028842 11:132165428-132165450 CTGTAGGAAGGCAATAAGTTAGG - Intronic
1091119409 11:133044305-133044327 CTGTAGGAATACAATAAGAAAGG + Intronic
1091856368 12:3743759-3743781 CTCTGGGAATGAAGTCAGCTGGG - Intronic
1092018330 12:5178617-5178639 CTGAGAGAATGAAAGAAGATGGG - Intergenic
1092790369 12:12065606-12065628 CTGTGGGAAGGTAAGTAGATGGG + Intronic
1092874969 12:12839958-12839980 ATGTGGGAATGACAGAAGAGTGG + Intergenic
1093783428 12:23164405-23164427 CTGTGGGAATAGAAAAAGAATGG - Intergenic
1094061948 12:26323692-26323714 CTGTGGGATCAAAATAAGAGTGG - Intergenic
1094639019 12:32255273-32255295 CTTTGGGAATTAAATGGGATTGG - Intronic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097006323 12:55921047-55921069 CTGTAGAAATGAAACAAGAGAGG + Intronic
1098076917 12:66741420-66741442 ATGTGGGGATAAAGTAAGATCGG + Intronic
1099292743 12:80791775-80791797 CTGTGGAAATGACTTAAGATAGG - Intergenic
1099339520 12:81410668-81410690 CTGTGGGATTAGAATAAGAAAGG - Intronic
1100910135 12:99350612-99350634 GTGTGAGAAAGAAATGAGATTGG + Intronic
1101125254 12:101627115-101627137 CTTTGAGAAATAAATAAGATTGG + Intronic
1101264557 12:103070062-103070084 CAGTGGCAAGGAAATAAAATTGG - Intergenic
1101767265 12:107713683-107713705 CTGTGGGAACTAGGTAAGATGGG + Intergenic
1101867810 12:108534886-108534908 CTATTTGAACGAAATAAGATAGG - Intronic
1102458559 12:113086402-113086424 CGGTGGGAAAGAAGTAAGAGAGG + Intronic
1106638623 13:31559015-31559037 TTGTGGGAATGCAATAAAAATGG + Intergenic
1108594933 13:51941408-51941430 ATGTGGGTATGAATTAAGATGGG + Intronic
1108675207 13:52730973-52730995 CTTGGGGAAGGAAAAAAGATGGG - Intronic
1109383625 13:61598653-61598675 CTGTGGGGATGAAATCAAACAGG - Intergenic
1111883025 13:93982505-93982527 ATGTGGGAATTAAATAATGTAGG - Intronic
1112110161 13:96287874-96287896 CTGTGAGAATTAAATAATCTAGG - Intronic
1112806826 13:103172284-103172306 CTGTGGTAATGAAAGAATACAGG - Intergenic
1113042366 13:106119014-106119036 CTGTGGGAATGCTGTCAGATAGG - Intergenic
1113339288 13:109406174-109406196 CTGTTGGAGTGAGATAAGATGGG - Intergenic
1114849088 14:26360855-26360877 CTGTGGGAATGAGGTAATGTGGG - Intergenic
1115080663 14:29446527-29446549 CTGTGGTAATGATACAAGTTTGG - Intergenic
1115389736 14:32841615-32841637 CTGTGAGAATGGACTAAAATTGG - Intergenic
1116470795 14:45283125-45283147 CTCTGGGAATGAACTAAGGCAGG + Intergenic
1116764063 14:49049520-49049542 CTGTGAGAATAAAATAAGGAGGG + Intergenic
1117324355 14:54655231-54655253 CTGTGGGAAGGACATATGACTGG - Intronic
1118293071 14:64543328-64543350 ATCTGGGAATTAAACAAGATTGG - Exonic
1118669377 14:68105905-68105927 CTATGGGAATGAAATAGAAGTGG + Intronic
1118677810 14:68207314-68207336 CTGTGGGAATGAATTAAAATTGG - Intronic
1119875676 14:78057137-78057159 GTGTGAGAATGAACTAATATAGG + Intergenic
1121072792 14:91039838-91039860 CTGTGAAAATTAAGTAAGATAGG + Intronic
1121476298 14:94208569-94208591 AAGTTGGTATGAAATAAGATTGG + Intronic
1123100567 14:105795943-105795965 CTGTGGGGAGGAGATAAGAGAGG + Intergenic
1124467604 15:29952403-29952425 CTGTGGGGATTAAATGGGATGGG - Intronic
1125276375 15:37996310-37996332 TGCTGGGAATGAAAGAAGATGGG + Intergenic
1126113813 15:45190779-45190801 GAGTAGGAATAAAATAAGATGGG + Intronic
1126254259 15:46606637-46606659 CTGAGAAAATGAAATAAGACAGG + Intergenic
1126736080 15:51733426-51733448 CTGAGGGAAAGAAAAAAAATTGG + Intronic
1127574833 15:60281199-60281221 CTGTGGAATTGTAATAAAATGGG - Intergenic
1129084321 15:73072574-73072596 TTGTGGGAATGAGATAGGGTAGG + Intronic
1129184941 15:73900225-73900247 TTGTGAGAATGAAACAAGACAGG + Intergenic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1130121317 15:81050037-81050059 CTGTGGAAATGAAAAGAGAAAGG + Intronic
1130233319 15:82113091-82113113 CTGTGGGAATCAAACAGGATGGG + Intergenic
1131017050 15:89066612-89066634 CCTTGGGAAGGAAATATGATAGG - Intergenic
1131768595 15:95709090-95709112 ATGTAGGATTGAAATAAAATTGG + Intergenic
1133695740 16:8260794-8260816 CTCATGGAATGAAATGAGATGGG + Intergenic
1134912833 16:18043631-18043653 CTGTGAGAGTGAAATAAGAAAGG + Intergenic
1135472582 16:22744566-22744588 CTGTGGAAATGAAATAGGTCTGG + Intergenic
1135774136 16:25241553-25241575 GCGTGGAAATGAAATGAGATTGG - Intronic
1136617817 16:31409401-31409423 GTGGTGAAATGAAATAAGATTGG + Intronic
1137989747 16:53142011-53142033 CTTTGGGAAAGGAATAAAATAGG + Intronic
1139047338 16:63077637-63077659 CTGTGAGACTGAGATGAGATCGG + Intergenic
1139089527 16:63628661-63628683 CTGTGGGAATAACATAATAAAGG + Intergenic
1141790147 16:86228773-86228795 ATGTGAGAATGAACTAATATGGG - Intergenic
1142445272 16:90132104-90132126 CTGTGGGTATGATAAAGGATGGG - Intergenic
1143268493 17:5658446-5658468 CTGTGAGGATTTAATAAGATTGG + Intergenic
1143344367 17:6239249-6239271 CTGTGAGAATTAAAAAAGCTGGG - Intergenic
1146810092 17:35896343-35896365 ATGTGGGAATGAAATAACCAGGG + Intergenic
1149319851 17:55471723-55471745 CTGTGGTAAGGAAAAAGGATGGG - Intergenic
1149946541 17:60933799-60933821 CATTGTGAATGAAATAATATAGG - Intronic
1150151316 17:62810780-62810802 CTGTGGGAATTAAATGAGAGAGG + Intergenic
1152055936 17:78026841-78026863 CCGTTGGAATGAAAATAGATGGG + Intronic
1154006496 18:10533794-10533816 CTATGGGAAAAAAATAAGTTAGG + Intronic
1155208563 18:23581551-23581573 CTGTGAGGATAAAACAAGATCGG + Intronic
1155808735 18:30205907-30205929 CTGTGGGAGTGAAATGGGAGCGG + Intergenic
1157947681 18:51999123-51999145 CTCTGGAAATGAAATCAGCTTGG - Intergenic
1158217923 18:55119558-55119580 CTGTGGGAAAGAGATTAGAGTGG - Intergenic
1158523732 18:58194084-58194106 CTGTGGGAAAGAATGAAGGTTGG + Intronic
1160277629 18:77452233-77452255 CTGTGGGAATGATAAACTATGGG - Intergenic
1160507451 18:79435095-79435117 CAGTGGGAAGGATATTAGATAGG + Intronic
1160651943 19:235738-235760 CTGTGGGTATGATAAAGGATGGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
925559747 2:5178177-5178199 CTCTGGGAATTAAATATCATAGG - Intergenic
926785890 2:16518135-16518157 CTGTGTGGCTGGAATAAGATGGG - Intergenic
926881416 2:17548628-17548650 ATGTGGGCAGGAAAGAAGATTGG - Intronic
927059984 2:19408030-19408052 TTGTGAGAATGAAAAAAGATGGG + Intergenic
927708145 2:25309751-25309773 TTGTAAGAATTAAATAAGATAGG + Intronic
929596046 2:43176716-43176738 CTGTGAGGATTAAATAAGGTAGG + Intergenic
930361173 2:50381902-50381924 CAGTAGGAATGATTTAAGATGGG + Intronic
930364278 2:50419560-50419582 CAGTGGGAAAGAAAAAAGAAAGG + Intronic
931346253 2:61449560-61449582 CTGTGGCTTTGTAATAAGATTGG - Intronic
932443643 2:71756721-71756743 CTGTGGGAAAGAATTAGGACAGG + Intergenic
933111377 2:78405959-78405981 TTGTTGGATTGAAAAAAGATAGG - Intergenic
933640196 2:84750609-84750631 GTGTGTTAATGAAATAAGATTGG + Intronic
934041515 2:88131056-88131078 CTGGGGGCATGAGATAACATGGG - Intergenic
935919714 2:107999833-107999855 CACTGGGAATGAAAAAATATCGG - Intronic
936098964 2:109558464-109558486 CTGTGGGAAAGAGATTAGTTAGG + Intronic
936480072 2:112877763-112877785 TTGTGGGAATTAAAGGAGATGGG - Intergenic
936482998 2:112902648-112902670 CTGTGGGCCTTAAATTAGATGGG + Intergenic
936750700 2:115638154-115638176 CTGTGGGAAGAAAATATCATGGG + Intronic
936924132 2:117719499-117719521 CTGTGAGGCTGAAATGAGATTGG - Intergenic
937323165 2:120972990-120973012 CTGTGGTAATGAATGAAGACTGG - Intronic
938834754 2:135089547-135089569 CTGAGGCAAGGAAATAAGAGAGG - Intronic
939792212 2:146591753-146591775 CTGTCATAATGGAATAAGATTGG - Intergenic
939903033 2:147874116-147874138 CTTTGACAGTGAAATAAGATAGG + Intronic
940859754 2:158759616-158759638 CTGTGGGAATGACATAGGATGGG - Intergenic
941086739 2:161126721-161126743 CAGTGAGAAAGAAATAAGAGAGG - Intergenic
942408824 2:175685050-175685072 TTGTTGGAAGGAAATAATATGGG - Intergenic
943955402 2:194182539-194182561 GTGAGGGGATCAAATAAGATTGG - Intergenic
944978045 2:205080111-205080133 CTGTGGGACTGAAACAAAATAGG - Intronic
946093664 2:217252936-217252958 CTGTTGGAAAAAAATAAGCTGGG - Intergenic
948228952 2:236335713-236335735 CTGTGTTAATGGAATAAGGTAGG - Intronic
948331488 2:237170208-237170230 CTTTGGGATTCAAATAAAATTGG - Intergenic
1168853690 20:993860-993882 CTGTGAGGATGAAATAAGGCTGG + Intronic
1169300081 20:4434690-4434712 ATGTGGGAAAGAAAGAAGTTGGG - Intergenic
1170032053 20:11954293-11954315 CTATGGCAATGAAATGACATGGG + Intergenic
1170064501 20:12296055-12296077 GTGTGGGAATGAAGAGAGATTGG - Intergenic
1171422503 20:25026599-25026621 CTGTGGGACAGGAATCAGATGGG - Intronic
1173359649 20:42330942-42330964 ATGTGCAAATGAAATAAGTTGGG - Intronic
1173540919 20:43850339-43850361 CTCTGGGAATGAGTTAAAATGGG - Intergenic
1174714877 20:52746926-52746948 CTGTTGGAATGAAACAGGATGGG + Intergenic
1176157180 20:63627637-63627659 CTGTGGGACTGCGATAGGATCGG - Intergenic
1176946438 21:14987928-14987950 CTGTGGCAATTGAATATGATAGG - Intronic
1178469447 21:32878974-32878996 CTGTGGGAAGGGTATAGGATGGG + Intergenic
1179345742 21:40555387-40555409 CTGTGGAAATGACATATCATTGG - Intronic
1179827147 21:43972507-43972529 CTGTCCCAATGAAATAAAATGGG + Intronic
1183492410 22:38123609-38123631 CTGTTGGAATTAAATAAGGCTGG + Intronic
1184405250 22:44297206-44297228 CTGTGTGAGTTAAATGAGATGGG - Intronic
949920599 3:8997207-8997229 ATGAGGGAATGAAGTAAGCTTGG - Intronic
950416127 3:12869834-12869856 CAGTGGAAATGAAAAAAAATAGG - Intronic
950990126 3:17425925-17425947 TTGTGGGAAGGAAACAAGTTAGG + Intronic
951723130 3:25723082-25723104 GTGTGGGTATAAAATATGATAGG + Intronic
952014757 3:28943101-28943123 CTTTAGGAATGAAAAAAAATTGG + Intergenic
952329091 3:32347457-32347479 CTGTGACAATAAAATAAGTTAGG + Intronic
953164141 3:40449421-40449443 GAGTAGAAATGAAATAAGATTGG + Intergenic
955130312 3:56159299-56159321 ATGTGAGAATGGAATAATATGGG + Intronic
955170735 3:56562377-56562399 CTGTGGTAATGAAGTAAACTTGG + Intronic
955307742 3:57851049-57851071 TTGTGAGAATTAAATAATATAGG - Intronic
955633936 3:61005084-61005106 TAGGGAGAATGAAATAAGATGGG - Intronic
955789537 3:62574078-62574100 CAGTGGGGATGGAATGAGATGGG - Intronic
956802516 3:72773567-72773589 CTATAGGAAAGAAACAAGATGGG + Intronic
956998931 3:74861908-74861930 GTCTGGGAATAAAATAAGACAGG + Intergenic
960498327 3:118404061-118404083 CAGTGGGTAGGAAATATGATTGG + Intergenic
960649622 3:119932396-119932418 CTGTGGGAAGGAAATGGGAAAGG + Intronic
960672847 3:120168944-120168966 CTGTGACAATCAAATAAGATTGG + Intronic
961253704 3:125527625-125527647 CAGTGGGAAGGCAATTAGATAGG + Intergenic
961437557 3:126930027-126930049 TAGTGGGAAAGAAATAACATGGG - Intronic
964184732 3:153929160-153929182 CTATGGGCAAGAAATAAAATTGG - Intergenic
965280585 3:166747312-166747334 ATGTGCGAATATAATAAGATGGG - Intergenic
965698496 3:171435406-171435428 CTGTGAGAAAGAAAAAGGATGGG + Intronic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
968365887 3:198184234-198184256 CTGTGGGTATGATAAAGGATGGG - Intergenic
969116606 4:4874180-4874202 ATGCGGGAATGAAATCAGACTGG - Intergenic
971036428 4:22697964-22697986 CTGGGGGAAAGAAATAAGAATGG - Intergenic
973195244 4:47432247-47432269 GTGTGGGAAGGAAAGAAGACAGG - Intergenic
973612168 4:52646093-52646115 CTGTGAGAATGGACTAATATAGG + Intronic
974527863 4:63067434-63067456 CTTAGTTAATGAAATAAGATGGG + Intergenic
975222598 4:71830800-71830822 TTGTGAGAATGAAACTAGATGGG + Intergenic
975282371 4:72575859-72575881 CTGTGTTTATGAAATAAAATTGG - Intergenic
976142851 4:82010611-82010633 TTATAGAAATGAAATAAGATGGG + Intronic
976495873 4:85728747-85728769 CTCTGGGAAAGAAAAAAGTTTGG + Intronic
976552965 4:86417410-86417432 TTGTGGCAATGAAAAAATATAGG - Intronic
976578606 4:86706653-86706675 CTTTGGGAACAAAATGAGATAGG + Intronic
977292831 4:95181763-95181785 CTGTGGGAAAGAAAGAAGGATGG + Intronic
978711947 4:111793594-111793616 CTGTGGGAATGGAAGAACAGAGG - Intergenic
979254923 4:118599392-118599414 CTGTGGGTATGATAAAGGATGGG - Intergenic
979334043 4:119446627-119446649 CTGTGGGTATGATAAAGGATGGG + Intergenic
979529805 4:121757795-121757817 CTGTGGGAATGACATAAGGATGG + Intergenic
979551404 4:121995265-121995287 TTCTGGGAAGGAAATAGGATGGG + Intergenic
980070795 4:128241318-128241340 CTGTTGTAAAGAAACAAGATGGG + Intergenic
980121633 4:128734002-128734024 CTTTTAAAATGAAATAAGATAGG + Intergenic
980262584 4:130471444-130471466 CAGTGGGAATGAAAAAAATTTGG + Intergenic
980526941 4:134001561-134001583 TTGTGAGAATGAAAGAAGTTGGG + Intergenic
981690894 4:147507695-147507717 CTGGGGAAATAAAATAATATTGG + Intronic
981974319 4:150705446-150705468 CTCTGGGCATGAAAAAAGAATGG + Intronic
982522309 4:156433589-156433611 CTGTGGGAATGGATTAGAATTGG + Intergenic
985006718 4:185541551-185541573 ACGTGGGAATGAAACAATATAGG - Intergenic
985437937 4:189950768-189950790 GTGTGTAAATGAAATGAGATTGG - Intronic
986550480 5:8948653-8948675 CTTTTGGAATAAAATAAAATTGG + Intergenic
988057287 5:26114553-26114575 CCGAGCCAATGAAATAAGATGGG + Intergenic
988531640 5:32032732-32032754 ATTTGGGAATTAAATAACATAGG - Intronic
989063871 5:37439766-37439788 ATATAGGAAAGAAATAAGATTGG - Intronic
989394922 5:40944257-40944279 CTGTGGGAATGAAACAAATCAGG - Intronic
991993002 5:72359964-72359986 GTGTGAGGATGAAATGAGATAGG + Intronic
992457607 5:76930454-76930476 CCATGGAAATTAAATAAGATTGG - Intergenic
992607848 5:78479258-78479280 CTTTAGAGATGAAATAAGATTGG + Intergenic
994097424 5:95859660-95859682 TTGGGGGAAAGAAACAAGATGGG + Exonic
994671311 5:102764855-102764877 ATGTGGGGTTGAAGTAAGATTGG - Intronic
994979975 5:106861756-106861778 GTGTGGGAAAGAAGGAAGATGGG - Intergenic
995419244 5:111944618-111944640 CTGTGGGAAACAAATAAAATTGG - Intronic
995652146 5:114381866-114381888 CTGTGGGACTGAACTAGGAGAGG + Intronic
996397073 5:123024092-123024114 AAGTGGGAAGGAAATAAGGTTGG + Intronic
996979749 5:129476396-129476418 CAGTAGGACTGAAATAAGAGTGG - Intronic
997393871 5:133540838-133540860 CTCTGGTAATGCAGTAAGATAGG - Intronic
998653015 5:144142446-144142468 AAGTGGGAATGACATCAGATAGG + Intergenic
999664957 5:153903338-153903360 CTCTGGGAATGGAGAAAGATGGG + Intergenic
999702193 5:154238312-154238334 CTATGGAAAGGAAATAAGCTAGG - Intronic
1001240002 5:170061411-170061433 CTGGGGGAATGAAATGAGCATGG + Intronic
1002323043 5:178387081-178387103 CCGTGGGAGAGAAATAAGGTGGG - Intronic
1002392700 5:178928242-178928264 ATGTGAGAAAGACATAAGATTGG - Intronic
1002772747 6:303545-303567 CAGTGGGAGTGAAGGAAGATAGG + Intronic
1005259623 6:24044092-24044114 TTGAGGGAAAGAAATAAAATTGG - Intergenic
1009277744 6:61705441-61705463 TTGTGGCAATTAAATAAGAAAGG - Intronic
1009950439 6:70389188-70389210 CTGTGGGAATAATAGAAGAAAGG + Intergenic
1010851807 6:80785744-80785766 ATGTGGGAATGGGATAATATAGG + Intergenic
1011489536 6:87876151-87876173 CTATGTGGCTGAAATAAGATTGG + Intergenic
1012394589 6:98781785-98781807 AGGTGGAAATGAAAAAAGATGGG + Intergenic
1012995973 6:105975174-105975196 CTCTGAGAATGAAATACGTTAGG - Intergenic
1013835309 6:114328015-114328037 CAGTGGAAATGAAATAATAGAGG + Intronic
1015401710 6:132795246-132795268 CTTTGGGAGTGAAAAAATATGGG - Intronic
1015504458 6:133967896-133967918 CTGTGCACATGAAACAAGATTGG - Intronic
1015744240 6:136492973-136492995 TTTTGGGAAGAAAATAAGATTGG + Intronic
1018428222 6:163702115-163702137 CTTAGAGAATGAAATAAGACGGG - Intergenic
1018880936 6:167879522-167879544 CTGAGGGAAGAAATTAAGATAGG - Intronic
1019539446 7:1545219-1545241 CTGTGGGGATCCAATAAGACAGG + Exonic
1020626491 7:10587521-10587543 CTGTGGGAATGAATTATTGTGGG + Intergenic
1021151286 7:17153598-17153620 CTGATGGAATGTAATAAGAAAGG + Intergenic
1022312000 7:29205970-29205992 AGGAGGGAATGAAATATGATGGG - Intronic
1024070013 7:45777069-45777091 CTGTGGGTATGATAAAGGATGGG - Intergenic
1024169772 7:46772769-46772791 CAGTGGGAGAGAAATGAGATTGG + Intergenic
1025099415 7:56122882-56122904 CTGTGGGTATGATACAGGATGGG + Intergenic
1026364934 7:69638662-69638684 CACTGTGAATGAAATAGGATAGG - Intronic
1027555303 7:79656985-79657007 CTTTGGAAATGAAAAAAGATGGG + Intergenic
1028189920 7:87835175-87835197 ATGTAGGAATGAGATAAGAAAGG - Exonic
1029910078 7:104136464-104136486 CTCTTGTATTGAAATAAGATGGG - Intronic
1031492463 7:122405805-122405827 CTTTGGAAATGAAATGAAATTGG + Intronic
1032047411 7:128621357-128621379 CTGTGGGTATGATAAAGGATGGG - Intergenic
1033963351 7:146942414-146942436 ATGGGAGAATGAAAGAAGATTGG + Intronic
1035392549 7:158514985-158515007 CTGTGGAGATAAAATAAGAGTGG - Intronic
1036401914 8:8416403-8416425 TTGTGGGAATTAAATACAATAGG - Intergenic
1037599904 8:20385235-20385257 CTGTGGGAATGAGAAAGGAAGGG + Intergenic
1038683433 8:29692791-29692813 CTGTGGAAAATAAATGAGATTGG + Intergenic
1039793302 8:40892184-40892206 CTGGATAAATGAAATAAGATGGG - Intronic
1041656327 8:60354182-60354204 CTGTGTGAATGAAGTACCATTGG + Intergenic
1043835778 8:85044127-85044149 CATTGGGAATGAACTAAGGTGGG - Intergenic
1045306678 8:100963289-100963311 GCTTAGGAATGAAATAAGATAGG + Intergenic
1045473070 8:102529505-102529527 CTCTGGGACTGAAATAAAACGGG - Exonic
1046863653 8:119122294-119122316 CTGAGGGATAGAAATAAGAATGG - Intergenic
1047045549 8:121048795-121048817 CTGTGTGATTCAAATAGGATGGG + Intergenic
1048260395 8:132940169-132940191 CTGTGTGAGTCAAATAAGATGGG + Intronic
1052777496 9:32747263-32747285 CTGTGGGAATTAAGTAAGAATGG + Intergenic
1054353198 9:64037802-64037824 CTGGGTTAATAAAATAAGATAGG - Intergenic
1056172468 9:83999504-83999526 CTGTGAAAATTAAAGAAGATAGG - Intronic
1059323850 9:113490294-113490316 GGGTGTAAATGAAATAAGATTGG - Intronic
1061630328 9:131868233-131868255 GTGTGGGAATTAAATGAGAGGGG - Intronic
1062750257 9:138247101-138247123 CTGTGGGTATGATAAAGGATGGG - Intergenic
1188070537 X:25713050-25713072 CTGTGGGAAAGACATCAGAAGGG + Intergenic
1188140678 X:26546826-26546848 CTGTGAGAATGAACTAATACAGG + Intergenic
1188352690 X:29151537-29151559 GTCTGGGAATGAAGTGAGATGGG + Intronic
1191605515 X:63057958-63057980 CTGTGGGAAAGAGATGAGTTTGG - Intergenic
1191958795 X:66676425-66676447 TTGTGAGAATTAAATAAGACAGG + Intergenic
1191979870 X:66913856-66913878 CTGTTGAAATGAAATCAGATGGG - Intergenic
1195829847 X:109044898-109044920 AATTGAGAATGAAATAAGATTGG - Intergenic
1195857894 X:109350320-109350342 CTGAGGGCATGACATAACATAGG - Intergenic
1195860538 X:109378153-109378175 TTGTGAGGATTAAATAAGATAGG - Intronic
1196070268 X:111513179-111513201 ATGTGGGATGGAGATAAGATGGG - Intergenic
1196310911 X:114164068-114164090 TTTTGGGAATGAAATTTGATAGG - Intergenic
1197095693 X:122592001-122592023 CTGCTGGAGGGAAATAAGATAGG - Intergenic
1197525691 X:127559695-127559717 ATGTGTATATGAAATAAGATTGG - Intergenic
1198046728 X:132911233-132911255 CGGTGGGAAGGAAATGAGTTAGG - Intronic
1198560706 X:137847221-137847243 GTGTTGGAATGAAATGAGAGGGG + Intergenic
1198814654 X:140576693-140576715 CAGTGAAAATGAAATAAGACTGG - Intergenic
1199472673 X:148212047-148212069 ATGTGGGAATGAAAACAGTTTGG + Intergenic
1201535710 Y:15045984-15046006 GTGTGAGAATGAAATAATACAGG + Intergenic