ID: 909478532

View in Genome Browser
Species Human (GRCh38)
Location 1:76109707-76109729
Sequence TGTAAGCCCGAGCTCTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909478532_909478535 -10 Left 909478532 1:76109707-76109729 CCACACAAGAGCTCGGGCTTACA 0: 1
1: 0
2: 0
3: 5
4: 115
Right 909478535 1:76109720-76109742 CGGGCTTACAGGCACACTTTGGG No data
909478532_909478537 22 Left 909478532 1:76109707-76109729 CCACACAAGAGCTCGGGCTTACA 0: 1
1: 0
2: 0
3: 5
4: 115
Right 909478537 1:76109752-76109774 TCTTCCCTGAAAACTGAGATGGG 0: 1
1: 0
2: 2
3: 29
4: 243
909478532_909478536 21 Left 909478532 1:76109707-76109729 CCACACAAGAGCTCGGGCTTACA 0: 1
1: 0
2: 0
3: 5
4: 115
Right 909478536 1:76109751-76109773 TTCTTCCCTGAAAACTGAGATGG 0: 1
1: 0
2: 3
3: 33
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909478532 Original CRISPR TGTAAGCCCGAGCTCTTGTG TGG (reversed) Intronic
901635433 1:10668133-10668155 TGTAAGTGCGAGCGCGTGTGAGG + Intronic
905189108 1:36219544-36219566 TGTAATCCCAACCTCTTGAGAGG - Intergenic
906965591 1:50453363-50453385 TCAAAGCCCCAGCTCTTGAGTGG - Intronic
909478532 1:76109707-76109729 TGTAAGCCCGAGCTCTTGTGTGG - Intronic
909647359 1:77932745-77932767 TGTAAGACCGAGGTATTTTGTGG - Intronic
909788328 1:79642701-79642723 TGTAAGCCCGACCGGGTGTGAGG + Intergenic
917455095 1:175179355-175179377 CGTAATCCCGAGCTCTGGTAGGG - Intronic
919218785 1:194598131-194598153 TGTAAGCTTTAGCTCTTGTCAGG - Intergenic
919455537 1:197815989-197816011 TGTTAGCCCAAGTTCTTTTGTGG - Intergenic
922048346 1:221967717-221967739 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
923257339 1:232233152-232233174 TGTAAGCCGGAGCAGGTGTGAGG + Intergenic
1065016059 10:21463886-21463908 TGTAAGCCCAAGATTTTGGGAGG + Intergenic
1065042581 10:21712605-21712627 TATAAACCAGAGCTCTTGGGAGG - Intronic
1068230909 10:54168516-54168538 TGTAAGCCCGACCAGGTGTGAGG - Intronic
1068592406 10:58864968-58864990 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1070474865 10:76820330-76820352 TGTAAGCCAGACCACGTGTGAGG - Intergenic
1071897796 10:90084990-90085012 TGTAAGCCAGAGCAGGTGTGAGG + Intergenic
1078367907 11:10721872-10721894 TGTCGGCCCCAGCTCCTGTGTGG - Intergenic
1083514901 11:63247688-63247710 TGTAATCCCAAGTACTTGTGAGG + Intronic
1092346132 12:7715965-7715987 TGTAAGTCCCAGCTGCTGTGGGG + Intronic
1096464139 12:51838864-51838886 TGCAAGGCAGAGCTCTTCTGGGG - Intergenic
1098052346 12:66467757-66467779 GGTAGGCCAGAGCTCATGTGAGG - Intronic
1100070034 12:90704343-90704365 TGTATGCCTGAACTATTGTGTGG - Intergenic
1101278461 12:103226629-103226651 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1104126963 12:125856875-125856897 TCTAAATCCTAGCTCTTGTGAGG + Intergenic
1105607804 13:21941747-21941769 TATAAGCCCTGGGTCTTGTGGGG - Intergenic
1106887782 13:34208484-34208506 TGTAATCCCCACTTCTTGTGTGG + Intergenic
1107683207 13:42871364-42871386 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1108512928 13:51171628-51171650 TGTAAGCCCGACCAGGTGTGAGG - Intergenic
1108814064 13:54268618-54268640 TGTAAGCCCGACCAGGTGTGAGG - Intergenic
1109716812 13:66230325-66230347 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1110211976 13:72984536-72984558 TGTAAGAATGAGCTGTTGTGAGG - Intronic
1111458906 13:88516774-88516796 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1111631770 13:90852537-90852559 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1113679556 13:112233677-112233699 AGTAAGACCGTGCACTTGTGGGG - Intergenic
1114880246 14:26775835-26775857 TGTAAGCACCAGCTGTTCTGAGG - Intergenic
1115240661 14:31249254-31249276 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1125349310 15:38751254-38751276 TGTGACCCAGAGCTGTTGTGAGG + Intergenic
1128032921 15:64497777-64497799 TGTAATCCCAACCTCTTGGGAGG + Intronic
1129179171 15:73860801-73860823 TGTGAGCAGGAGCTGTTGTGTGG + Intergenic
1130285430 15:82550630-82550652 TGTAATCCCAAACTCTTTTGTGG - Intronic
1134622375 16:15699218-15699240 TGTAACCCCCAGCACTTGGGAGG - Intronic
1137879025 16:52027033-52027055 TGTATTCCCAAGCTCCTGTGCGG + Exonic
1139562370 16:67751365-67751387 TGTAATCCCAAGCACTTGGGAGG + Intronic
1139781435 16:69354806-69354828 TGTAATCCCGACCTCTCGGGAGG - Intronic
1139917985 16:70439660-70439682 TGAAAGCCCGAGCTGCGGTGGGG + Intergenic
1141752655 16:85969493-85969515 TGTCATCCTGAGCCCTTGTGAGG + Intergenic
1144104605 17:11973668-11973690 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
1151790389 17:76302018-76302040 TGTAATCCCAAGCACTTGGGAGG - Intronic
1157491468 18:48126778-48126800 TGTAAGGCTGAGCATTTGTGTGG + Intronic
1160497172 18:79382559-79382581 TGGACGCCCGAGCTATTTTGGGG - Intergenic
928779746 2:34804840-34804862 TGTAAGCCGGACCTGGTGTGAGG + Intergenic
932295789 2:70622382-70622404 TGTAAGCCCGACCAGGTGTGAGG - Intronic
936883270 2:117280504-117280526 TGTAAGCCGGAGCAAGTGTGAGG - Intergenic
939307342 2:140427880-140427902 TGTAAGCCGGACCCCGTGTGAGG - Intronic
941113556 2:161445345-161445367 TGTAAGCCCAAGCACTTGGGGGG - Intronic
941353320 2:164460877-164460899 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
942714924 2:178881282-178881304 TGTATGCCAGTGCTCTTCTGGGG + Intronic
943144940 2:184031490-184031512 TCTAAGCCTGAGCTCTTAAGTGG + Intergenic
943354167 2:186831250-186831272 TGGAAACCAGAGCTCTTGTGGGG - Intronic
944526872 2:200628493-200628515 TGTAAATCAGAGATCTTGTGAGG - Intronic
944976145 2:205053516-205053538 TGTAATCCCAAGCACTTGAGAGG + Intronic
945394236 2:209300987-209301009 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
948897661 2:240934798-240934820 TGCAAGCCAGAGCTCTTGGGCGG - Intronic
1178269059 21:31172744-31172766 TGTAATCCCAAACTCTTGAGAGG + Intronic
1178431383 21:32521397-32521419 TGTAAGCCTGAGCACCAGTGTGG + Intergenic
949827375 3:8178779-8178801 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
953361360 3:42300207-42300229 TGAAAGCCTGAGGTTTTGTGTGG - Intergenic
954629675 3:52041040-52041062 AGAAATCCCAAGCTCTTGTGTGG + Intergenic
954969331 3:54638430-54638452 TGTAAGCCGGAGCAGGTGTGAGG + Intronic
959262255 3:104097804-104097826 TGTGAGCCCAAGCACTGGTGTGG + Intergenic
965262721 3:166504760-166504782 TGTAAGCCAGACCTGGTGTGAGG + Intergenic
966232916 3:177669794-177669816 TGTAAGCCGGACCAGTTGTGAGG + Intergenic
968679270 4:1905481-1905503 TGGAGGCCTGAGCTCCTGTGGGG + Intronic
969003880 4:4004190-4004212 TGTAAGCTGGAGCTGGTGTGAGG + Intergenic
969810047 4:9640634-9640656 TGTAAGCTGGAGCTGGTGTGAGG - Intergenic
970490225 4:16564522-16564544 TGTCACCCCCATCTCTTGTGAGG + Intronic
972221601 4:36962316-36962338 TGTAATCCCAGCCTCTTGTGGGG - Intergenic
976711062 4:88072237-88072259 TGTAATCCCGGCCTTTTGTGAGG - Intronic
980061796 4:128138699-128138721 TGTAATCCCAACCTTTTGTGAGG + Intronic
982180546 4:152745304-152745326 TGTAAGCCGGAGCAGGTGTGAGG + Intronic
984700599 4:182816281-182816303 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
986193470 5:5517316-5517338 TGTAAGCCAGAGCAGGTGTGAGG - Intergenic
986388813 5:7265345-7265367 TGTAAGCCCGACCAGGTGTGAGG - Intergenic
986905710 5:12491596-12491618 TGTAAGCCCGACCAGGTGTGAGG - Intergenic
988150520 5:27372527-27372549 TGTAAATCCAAGATCTTGTGGGG + Intergenic
994779064 5:104068487-104068509 TGTAAGCCCGACCGGATGTGAGG + Intergenic
995125273 5:108572771-108572793 TGTAAGCCCGACCGGATGTGAGG + Intergenic
998693773 5:144615331-144615353 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1000383218 5:160647572-160647594 TGTTAGCCTGAGCTGTTCTGGGG + Intronic
1001917912 5:175576921-175576943 TGTAATCCCGACCCCTTGGGAGG + Intergenic
1002611033 5:180418677-180418699 TGTAAGCCAGAGCAGGTGTGAGG + Intergenic
1003430234 6:6031733-6031755 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1005582924 6:27250938-27250960 TGTAATCTCGGGCTCTTGTGAGG - Intronic
1006716114 6:36121610-36121632 TGTCAGCCCGAGCACAGGTGTGG - Intergenic
1009880003 6:69554953-69554975 TGTAAGCCAGAGATCCTGGGAGG - Intergenic
1010894609 6:81349081-81349103 TGTAAGCCAGACCAGTTGTGAGG + Intergenic
1015977158 6:138802024-138802046 TGGAAGCCGGAGCCCTTGTGTGG - Intronic
1018103748 6:160464324-160464346 TGTAAGCTCCAGCTCACGTGGGG + Intergenic
1018131220 6:160733955-160733977 TGTAAGCTCCAGCTCACGTGGGG - Intronic
1021294706 7:18890209-18890231 TATAATCCAGAGCTCTTTTGAGG - Intronic
1021977964 7:26028136-26028158 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1022372807 7:29786610-29786632 TGTAAGCCAGACCTGGTGTGAGG - Intergenic
1022709000 7:32834128-32834150 TGTAAGCCCGACCGGGTGTGAGG - Intergenic
1024576564 7:50769348-50769370 GGGAAGCCCGACCTCCTGTGTGG - Intronic
1030206157 7:106954206-106954228 TGGAATCCTGAGCTCCTGTGAGG - Intergenic
1035568026 8:654731-654753 TGTCAGCCCAAGTCCTTGTGGGG - Intronic
1042511324 8:69615145-69615167 TGAAAGCCTGAGCTCAGGTGAGG - Intronic
1051849356 9:21489653-21489675 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1057067986 9:92073050-92073072 TGTAAGCCAGAGCAGGTGTGAGG - Intronic
1059262681 9:112993693-112993715 TCTGAGACTGAGCTCTTGTGGGG - Intergenic
1060920202 9:127415045-127415067 TGTAAGCCAGAGCGGGTGTGAGG - Intergenic
1188140717 X:26547327-26547349 TCTAGGCGCAAGCTCTTGTGTGG - Intergenic
1193145160 X:78068629-78068651 TGTAATCCCGACCACTTGGGAGG - Intronic
1195291228 X:103433515-103433537 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1195908745 X:109869165-109869187 TGTAAGCCCGACCAGGTGTGAGG + Intergenic
1196330757 X:114468523-114468545 TGTAAGCCAGACCTGGTGTGAGG - Intergenic
1196627361 X:117891649-117891671 TGCATGCCCGAGCTTTGGTGAGG + Intergenic
1199411382 X:147528034-147528056 TGTAATCCCCAACTGTTGTGGGG + Intergenic
1200611209 Y:5328727-5328749 TGTAAGCCGGAGCAGGTGTGAGG + Intronic