ID: 909480289

View in Genome Browser
Species Human (GRCh38)
Location 1:76123024-76123046
Sequence ATCTTGTTAAAATGCAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 2, 1: 12, 2: 41, 3: 96, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909480289_909480292 22 Left 909480289 1:76123024-76123046 CCAGATCTGCATTTTAACAAGAT 0: 2
1: 12
2: 41
3: 96
4: 412
Right 909480292 1:76123069-76123091 TAATGTTTAAGAAGTTTTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 360
909480289_909480294 27 Left 909480289 1:76123024-76123046 CCAGATCTGCATTTTAACAAGAT 0: 2
1: 12
2: 41
3: 96
4: 412
Right 909480294 1:76123074-76123096 TTTAAGAAGTTTTGCTGGCTGGG No data
909480289_909480293 26 Left 909480289 1:76123024-76123046 CCAGATCTGCATTTTAACAAGAT 0: 2
1: 12
2: 41
3: 96
4: 412
Right 909480293 1:76123073-76123095 GTTTAAGAAGTTTTGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909480289 Original CRISPR ATCTTGTTAAAATGCAGATC TGG (reversed) Intronic
902068939 1:13715664-13715686 ATCTTGTAAAAATCAAGAGCTGG - Intronic
902104776 1:14025522-14025544 ATCCTGTTAGAATACAGATTTGG - Intergenic
902422547 1:16292701-16292723 TTCTTGTTAAAATGGAGCTCTGG - Intronic
903368341 1:22818485-22818507 ATCTTTCTAAAATGGAAATCTGG + Intronic
903719399 1:25393318-25393340 ACCCTGTTAAAATGCAAGTCAGG + Intronic
904021751 1:27472029-27472051 ATCTTTTAAAAATGGAAATCAGG + Intronic
904089148 1:27932369-27932391 ATCTTTCTAAAATGCAAATTAGG + Intergenic
904610665 1:31724551-31724573 ATCTTTCCAAAATGCAGATCTGG - Intergenic
904883363 1:33717257-33717279 ATCTTGCTAAAACTGAGATCTGG - Intronic
906385420 1:45364595-45364617 ATCTTTCTAAAATGCAGTTTGGG - Intronic
906924183 1:50096906-50096928 ATTTTAATAAAATGCAGAACTGG - Intronic
906973386 1:50543164-50543186 ATCTTGTTTAAATTCAAAACAGG + Intronic
907088197 1:51698352-51698374 ATTTTTTTAAAATGCTGATTTGG - Intronic
907918126 1:58889203-58889225 ATCTTCCTAAAATGCAGGTCAGG + Intergenic
908650076 1:66323071-66323093 ATCTTTTTAAAATCCAAATTTGG + Intronic
908715372 1:67064220-67064242 ATTCTGTAAAAATGCAGATCTGG + Intergenic
909338649 1:74506670-74506692 ATCTTGTTAAAATGCAGATTCGG - Intronic
909480289 1:76123024-76123046 ATCTTGTTAAAATGCAGATCTGG - Intronic
912567830 1:110601152-110601174 TTCTTTTTAAAAAGCAGCTCTGG + Intronic
912745434 1:112241943-112241965 AGCTTTTTAAAATGCATGTCAGG - Intergenic
913085623 1:115433944-115433966 ATCTTCCTAATTTGCAGATCAGG - Intergenic
914457450 1:147849281-147849303 AACTTCTTCAAATGCAAATCTGG + Intergenic
915291539 1:154887538-154887560 GTCTTTTGAAAATGCAAATCTGG + Intergenic
915948556 1:160172140-160172162 ATTGTTTTGAAATGCAGATCTGG + Intronic
915980713 1:160418263-160418285 ATCTTGTTAAAATGCAGATTTGG + Intronic
915991374 1:160520479-160520501 ATCTTATTAAAATGCTGATTGGG - Intronic
916024199 1:160819912-160819934 ATCTTGTTAAAATACAGGTTTGG - Intronic
916379271 1:164190254-164190276 ATTTTGTTAACATGAAAATCTGG + Intergenic
916520979 1:165563292-165563314 GTCTTGTTGAGATGCAGATTTGG + Intronic
916728926 1:167549312-167549334 AGCTTGATAAAATGCTGATTTGG + Intronic
916986072 1:170192283-170192305 ATCTTGGCAACCTGCAGATCAGG - Intergenic
917238254 1:172918001-172918023 GAATTGTTAAAATGCAGTTCTGG - Intergenic
917798107 1:178546530-178546552 ATATTTTTAAAATACAGATAGGG - Intronic
918515646 1:185359552-185359574 ATCTTGTTAAGAACCATATCTGG - Intergenic
919195911 1:194286146-194286168 ATCTTGTTAAAATGTAAAGGAGG + Intergenic
920336442 1:205248400-205248422 ATTTTTTTAAAATGGAGATGGGG - Intronic
920595832 1:207268986-207269008 ATTTTGTTACAATGCTGCTCTGG + Intergenic
921346802 1:214194643-214194665 ATCTTGTCAAAATTAAAATCTGG + Intergenic
921821255 1:219619682-219619704 ATCTTGTTAAAACGCAAGTCTGG - Intergenic
922228152 1:223663675-223663697 ATGTTGATAAAATCCAGATTGGG - Intronic
922950292 1:229553408-229553430 ATCATTTAAAAATGCAAATCTGG - Intronic
923741580 1:236659563-236659585 ATCTCGTTAAAACACAGATTGGG - Intergenic
924201987 1:241669923-241669945 ATCTTGTTAAAATGCAGATTTGG - Intronic
924317180 1:242810493-242810515 AACTGGTTAAAGTGCATATCGGG - Intergenic
924762416 1:247000773-247000795 ATCTTGTTAAAATGCAGGCACGG + Intronic
1064136693 10:12757075-12757097 AGCTTCTTAGGATGCAGATCTGG - Intronic
1064412531 10:15119670-15119692 ATCTTGTTGAGTTGCAGATTCGG - Intronic
1064812571 10:19217148-19217170 ATCTTTCTAAAATGCAAACCTGG + Intronic
1065196318 10:23269576-23269598 ATCTAGTTAAAATGCAGAAATGG + Intronic
1065962153 10:30742502-30742524 ATCTTTCCAAAATGCATATCTGG + Intergenic
1068291852 10:55013304-55013326 ATCTTTTGAAAATGCAAATGTGG + Intronic
1070197747 10:74174510-74174532 ATCTTGTTAAAATGCAGGTTTGG - Intronic
1071826841 10:89333857-89333879 ATCTTTTTAAAATGCAGATCTGG - Intronic
1073118841 10:101108839-101108861 AGCTTGTTAAAATACAGTACCGG + Intronic
1073183359 10:101600160-101600182 ATTTTGTTTAAATGCAGCTTTGG + Intronic
1073568229 10:104553967-104553989 AACTTGTTAAAATGCAGACTTGG + Intergenic
1073652081 10:105371833-105371855 TTCTTGTTACAATGCAAATTCGG - Intergenic
1073778467 10:106811523-106811545 AGCTTGTTAAACTGCAGATCTGG - Intronic
1073873643 10:107896290-107896312 ATCTTGTTAAAAATCAGAAAAGG - Intergenic
1074954218 10:118371781-118371803 ATATTAGTAAAATGCAAATCAGG - Intergenic
1075950561 10:126474105-126474127 AACTGGTTACAATGCAGATTCGG - Intronic
1077391405 11:2302210-2302232 ATCTTGGTAACAGGCAGGTCGGG + Exonic
1078685495 11:13526876-13526898 CTCTTTTTAAAATGGAGATAGGG + Intergenic
1079981962 11:27160620-27160642 CTCTTGTTAAAATGCAACTTTGG + Intergenic
1081050267 11:38331524-38331546 TTCTTGTTCAAATGCATCTCAGG - Intergenic
1081078995 11:38715469-38715491 CTATAGCTAAAATGCAGATCTGG - Intergenic
1081268072 11:41051470-41051492 ATCTTATTAAAAGACACATCTGG + Intronic
1082009322 11:47439628-47439650 ATCTCGTAGAAATGCACATCTGG + Intronic
1083398132 11:62405329-62405351 ATCTTTTAAAAATGTAAATCAGG - Intronic
1084029025 11:66470098-66470120 AGTTTGTTAAAATCCAGATGAGG - Intronic
1085206581 11:74737061-74737083 ATCTTTTAAAAATGTAAATCAGG + Intergenic
1086533707 11:87816805-87816827 AGCTTGTAAAAATGCAGATATGG + Intergenic
1088223069 11:107590561-107590583 CCCTTGTTGAAATGCAGATATGG + Intergenic
1089127045 11:116183882-116183904 ATCTTGATAAAATGCAGACTCGG + Intergenic
1089369372 11:117944117-117944139 ATCTTTTAAAAATGTAAATCAGG - Intergenic
1090540101 11:127692439-127692461 ATCTGTTTACAAAGCAGATCTGG - Intergenic
1090810079 11:130231396-130231418 ATACTGTGAAAATGCATATCTGG - Exonic
1091647234 12:2283111-2283133 ATCTTGTTAAAATATAGGTTTGG + Intronic
1091847915 12:3671526-3671548 ACCCTGCTAAAATGCAGATTCGG + Intronic
1092248310 12:6876290-6876312 GTTTTTCTAAAATGCAGATCTGG - Intronic
1092287851 12:7139942-7139964 ATCTTGTTAAAATGTAAATCTGG - Intronic
1092757502 12:11777546-11777568 ATTGTGTCAAAATGCAAATCTGG + Intronic
1093854158 12:24078559-24078581 ATCTTTTAAAAATGCAAATCTGG - Intergenic
1095566658 12:43632318-43632340 TTATTTTTAAAATGCAGATCTGG + Intergenic
1097038617 12:56140692-56140714 ATCTTCCCAAAATGCAAATCTGG - Intronic
1097850688 12:64406857-64406879 GTCTTTTAAAAATGCTGATCTGG + Intronic
1098152254 12:67558738-67558760 GTCTTGTTAAAGTGCAGATTTGG + Intergenic
1099368260 12:81796974-81796996 ATCTTCTTAAAATGAAAAACTGG - Intergenic
1099420532 12:82453360-82453382 ATACTGTTAAACTGCAGATGAGG - Intronic
1100585417 12:95975233-95975255 ATCTTGTTAAAATGCAGGTGTGG - Intronic
1101082320 12:101201110-101201132 ATGGTTTTAAAATGCAGTTCTGG - Intronic
1101257040 12:102988868-102988890 ATGTTGAAAAACTGCAGATCAGG - Intergenic
1101401863 12:104395098-104395120 TGCTTGTTAAAATACAAATCTGG - Intergenic
1101415211 12:104502915-104502937 TTCTGGTTAAAGTGCAGATCTGG + Intronic
1101681674 12:106974254-106974276 AGGTTGTTAAAATGCAGTCCTGG - Intronic
1101851695 12:108408502-108408524 ATCATGTTAAAATGCAGATTGGG + Intergenic
1103078578 12:118005243-118005265 ACCTTGTTACAATGGAGATTTGG + Intergenic
1103280495 12:119754244-119754266 ATCTTTTTAAAAGGCAGGACTGG + Intronic
1103990024 12:124792786-124792808 CTCCTGTTAAAATTCAGATTTGG + Intronic
1105594260 13:21821336-21821358 ATCTGTTTAAAATGCAGATTCGG - Intergenic
1106851833 13:33802059-33802081 ATATTGTTAAAACGCACACCAGG + Intergenic
1107009678 13:35656094-35656116 ATCTTCTAAAAATTCAGAGCAGG - Intronic
1107194221 13:37628462-37628484 AACTTGTTAAAATCAAGATAGGG + Intergenic
1107780538 13:43897303-43897325 ATTGTTTTAAAATGCAAATCTGG + Intergenic
1108331812 13:49393324-49393346 AGTTTTTTAAAATACAGATCTGG - Intronic
1109053335 13:57512862-57512884 ATCTTGTAAATATCCAGAACTGG - Intergenic
1109269016 13:60233525-60233547 ATCTTTCTAAAATACAAATCTGG - Intergenic
1109932983 13:69241930-69241952 TTCTTGTTAAAATGCACAAATGG - Intergenic
1111281726 13:86034464-86034486 ACCTTGTTAAAATGCATATTTGG + Intergenic
1111388766 13:87563590-87563612 TTCTTGTTAGAATACACATCAGG + Intergenic
1117000643 14:51367452-51367474 ATCTAGTTAAAATGCAGATGAGG - Intergenic
1117012738 14:51487460-51487482 ATCTTGTGAAAATGCAAGACTGG + Intergenic
1117971883 14:61259500-61259522 ATCTTGTTAAACTGAAATTCAGG + Intronic
1119130686 14:72169885-72169907 ATCTTGGTAAAATGCAGATTCGG - Intronic
1119231187 14:72981092-72981114 ATTCTGTTAGAATGCAGATTCGG - Intronic
1119233028 14:72995949-72995971 ATCTTTTGAAAATATAGATCTGG + Intronic
1119542701 14:75451187-75451209 ATCTTTCTAAAATGCAAATCTGG - Intronic
1121469264 14:94139228-94139250 GTCTTGTTAAAATTCAGATTCGG + Intergenic
1121583774 14:95049059-95049081 CTCCTTTTAAAATGCAAATCAGG + Intergenic
1122424845 14:101599881-101599903 ATCTTGTCAATAAGCAGATGAGG + Intergenic
1123503850 15:20918028-20918050 ATATTTTTAAAATGCTGACCTGG - Intergenic
1123561098 15:21491700-21491722 ATATTTTTAAAATGCTGACCTGG - Intergenic
1123597338 15:21928993-21929015 ATATTTTTAAAATGCTGACCTGG - Intergenic
1124407502 15:29405086-29405108 ATCTTTTTAAAATGCAAACCTGG + Intronic
1124492271 15:30165346-30165368 ATCTTCATAAAATGCAAAGCCGG + Intergenic
1124605099 15:31163662-31163684 AACTTTAAAAAATGCAGATCTGG + Intergenic
1124751265 15:32372971-32372993 ATCTTCATAAAATGCAAAGCCGG - Intergenic
1125289609 15:38131075-38131097 AAATTGTTACCATGCAGATCTGG + Intergenic
1126110058 15:45169681-45169703 ATCTTCTCAAAAGACAGATCTGG + Intronic
1126182652 15:45800974-45800996 ATCTTGTAAAAGGGCAGATGTGG + Intergenic
1126680990 15:51202058-51202080 ATCTTGTTGCAGTGCAGATTTGG + Intergenic
1127464672 15:59232320-59232342 ATCTTGTCAAAATGCAGATGTGG + Intronic
1129327486 15:74808751-74808773 GTCTTTCTAAAATGCAGATCTGG - Intergenic
1129506468 15:76085559-76085581 GTCTTTTGAAAATGCAAATCTGG - Intronic
1129824738 15:78627292-78627314 ACCTGGTTAAAATGCAGGTTTGG + Intronic
1130529912 15:84739022-84739044 ATATTGTTAAAATTCATCTCAGG - Intergenic
1130690625 15:86078896-86078918 ATCTGGTTTAAATGCAGTTTCGG + Intergenic
1131022366 15:89109556-89109578 ATCCAGTTAAAATGAACATCAGG - Intronic
1131129801 15:89890561-89890583 ATGCTGTTAAAATACAGATTCGG + Intronic
1131708428 15:95024370-95024392 GTCTTTTAAAAATGCTGATCTGG - Intergenic
1131861944 15:96663176-96663198 AATTTGTTAAAATGCAGATCTGG + Intergenic
1202969444 15_KI270727v1_random:218866-218888 ATATTTTTAAAATGCTGACCTGG - Intergenic
1133338987 16:5024676-5024698 ATCTTGTTAAAATGCAGATTTGG - Intergenic
1134343397 16:13366429-13366451 ATCTTGTTGAAACACAGATTTGG + Intergenic
1135633927 16:24057893-24057915 ATCTTTCTAAAATGTAAATCAGG + Intronic
1135651428 16:24209800-24209822 ATCCTGTTTAAATGTAAATCAGG + Intronic
1135822607 16:25697632-25697654 ATCTTGTTAACATGTAGATTTGG + Intronic
1135997059 16:27258408-27258430 GTATTGTTAAAATGCACATTAGG - Intronic
1136363413 16:29796635-29796657 ATCTTGTGAAAATGTGGATTTGG - Intronic
1137754478 16:50890437-50890459 ATTTTGTTAAAATGGAGAACAGG + Intergenic
1138177321 16:54912563-54912585 ATATATTTAAAATGCAGACCTGG + Intergenic
1138938712 16:61762870-61762892 ATCTTGTTAAAACACAGATTGGG - Intronic
1140182907 16:72737887-72737909 AGCTTGTTAAAATGGAGAACAGG + Intergenic
1140526228 16:75625232-75625254 ATCTTTTCAAACTGCAAATCTGG + Intergenic
1140912094 16:79463322-79463344 ATCTTATTAAAATGTAAATCAGG - Intergenic
1140951284 16:79820322-79820344 ATCTTGTTAAAATGCAGACTTGG + Intergenic
1141006444 16:80357293-80357315 ATATTGTTAAAACGCAGGTCAGG + Intergenic
1141366611 16:83449440-83449462 ATCCTGTTCTAATGCAGAGCAGG + Intronic
1143075865 17:4342753-4342775 ATCTCATTAAAATGTAAATCAGG + Intronic
1144006942 17:11109349-11109371 ATCTTGTTGAAATGAACATTTGG - Intergenic
1144034871 17:11356019-11356041 ATCTTATTACAAGGCAGATTTGG - Intronic
1144809206 17:17987928-17987950 ATGTTGTTGAAAGACAGATCTGG - Exonic
1146306016 17:31730399-31730421 ATCTTGTTAAAATACAGATTGGG + Intergenic
1148616317 17:49003382-49003404 AACATTTTAAAATTCAGATCTGG + Intronic
1148874599 17:50679504-50679526 ATCTTGTTAAAATGCAACGCCGG - Intronic
1149728218 17:58918921-58918943 ATCTAGATAAAATGCAGAAAAGG + Intronic
1149817585 17:59741244-59741266 ATATTCATAAATTGCAGATCTGG - Intronic
1150095452 17:62370782-62370804 GTCTTGTTAAAATGCAGATTTGG + Intronic
1150810550 17:68353422-68353444 GTCTTGTTAAAAAGCAGACCTGG - Intronic
1151010440 17:70487494-70487516 ATCATGTTAAAATTCATCTCTGG + Intergenic
1152152013 17:78607586-78607608 ATCTTGTTAAAATAAAAATGTGG + Intergenic
1152919677 17:83059668-83059690 ATCTTTCCAAAATGCAGATCTGG + Intergenic
1153515935 18:5901213-5901235 ATCTTGTGAAAATGAAGATTTGG - Intergenic
1155153341 18:23138960-23138982 ATCTCGTTAAACTGCAGATCTGG - Intronic
1155668800 18:28344408-28344430 ATCTTGTTGGAAAGCAGATTTGG + Intergenic
1156147273 18:34199324-34199346 ATCTACTTAAAATGCTGATTAGG - Intronic
1157057517 18:44248364-44248386 ATTTTGTTAAAATAAAGATGAGG - Intergenic
1157786957 18:50492282-50492304 GTCTCATTAAAATGCAGCTCTGG - Intergenic
1158557572 18:58487961-58487983 ACCCTGTTAAAATGCTGATTTGG + Intronic
1158623127 18:59049741-59049763 TGCTTGTTAAAATGCAGACTTGG - Intergenic
1158641017 18:59203609-59203631 CTATTGGTAAAATGCAGGTCAGG + Intergenic
1158719832 18:59915058-59915080 ATCTTTTTAAAAAGCAGAGCAGG + Intergenic
1159014154 18:63088193-63088215 ATCTTTTTAAAACACAAATCTGG + Intergenic
1159223343 18:65495550-65495572 ATCTTGGGCAAATGCATATCAGG + Intergenic
1159229976 18:65593771-65593793 TTAGAGTTAAAATGCAGATCTGG - Intergenic
1159579314 18:70217465-70217487 ATCTTTTCAAAATGTAAATCTGG + Intergenic
1165254488 19:34567373-34567395 ATGTTGTTAACATTCAGATGGGG + Intergenic
1166412790 19:42567689-42567711 ATCTTGATTAAATACAGATTCGG + Intergenic
1167064686 19:47175772-47175794 ATCTCATTAAATTTCAGATCTGG + Intronic
1167270896 19:48505422-48505444 CTCTTTTTAAAATGCATTTCTGG + Intronic
925597880 2:5574151-5574173 ATTTAGTTAAAATTAAGATCAGG - Intergenic
926499111 2:13630909-13630931 ATCTTGTTGAAATGAAAATAGGG + Intergenic
926645502 2:15286320-15286342 ATCTTATCAAAATGCAAAGCTGG + Intronic
926671075 2:15577397-15577419 ATTCTGTTAAAATGCAGATATGG - Intergenic
926712188 2:15890530-15890552 CTCTTGTAAAAATGCAGATGCGG - Intergenic
927096873 2:19754106-19754128 ATCTTTCTAAAGTGCAAATCTGG - Intergenic
927288003 2:21376994-21377016 ATCCTCTTGAAATACAGATCAGG - Intergenic
927320793 2:21743325-21743347 ATATTGTTAAAATGGACATATGG - Intergenic
927850940 2:26498888-26498910 AACTTCTGAAAATGCAAATCTGG - Intronic
927998123 2:27500697-27500719 ATCTTGTTAAAATGCTCAGTAGG - Intronic
928661633 2:33507825-33507847 ATCTTTTAAAAATCCAGATATGG - Intronic
928913585 2:36447768-36447790 ATCTTGGTTAAATGTAGATTAGG - Intronic
929113879 2:38428260-38428282 ATCCTGTTGAAATGCAGATTCGG - Intergenic
929462990 2:42118241-42118263 ATCCTGTAAAAATGCAGATTTGG - Intergenic
929794484 2:45048529-45048551 GTCAAGTTAAAATGCAGATTTGG + Intergenic
930310148 2:49730083-49730105 ATTTTCTTAAAATTCAGATCAGG + Intergenic
930364168 2:50418004-50418026 ATCTTTCTAAAATGCACATTTGG - Intronic
930393850 2:50795239-50795261 ACCTTGTTAAAATGTAAATGTGG - Intronic
931278890 2:60770350-60770372 ATGTGGTTAAAATACAAATCGGG + Intronic
931334578 2:61326523-61326545 ATCCTTTTAAAATGCAAACCTGG - Intronic
931424238 2:62156456-62156478 ATATTTTTAAAATACATATCTGG - Intergenic
932923939 2:75948404-75948426 TTCTAGTTGAAATGCAGATTTGG + Intergenic
932966929 2:76487130-76487152 ATATTGATAATATGCCGATCAGG + Intergenic
933402122 2:81811720-81811742 ATTTGGTTAAAATACAGATTCGG + Intergenic
936661700 2:114550155-114550177 AGCTTTCTAAAATGCAGGTCCGG + Intronic
937056493 2:118941712-118941734 ATCTAGTTAAACTGTAGATTTGG + Intergenic
937122280 2:119449078-119449100 ATATTGTTAAAATGCAGGTTTGG + Intronic
937882851 2:126881556-126881578 ACTTTCTTAAAATCCAGATCTGG + Intergenic
938164649 2:129016247-129016269 AGCTTTCTAAAATGCAAATCTGG + Intergenic
939032529 2:137093620-137093642 ATCTTTTAAAAATGTAGCTCAGG + Intronic
939425022 2:142024368-142024390 GACTTGTTAAAATACAGTTCTGG + Intronic
939778506 2:146414983-146415005 ATTTTCTAAAAATGCAGATTTGG + Intergenic
940020528 2:149151801-149151823 ATCATCTGAAAATGCAGATGAGG + Intronic
940208281 2:151228865-151228887 ATCTTTTTAAAATTTAGATGTGG - Intergenic
940708504 2:157133427-157133449 ATATGGGTAAACTGCAGATCAGG - Intergenic
940986157 2:160054007-160054029 ATCTTGTTCAAATGCAAACAAGG - Intronic
941434599 2:165453688-165453710 ATGTTAATAATATGCAGATCTGG - Intergenic
942220224 2:173761878-173761900 ATCTTGTTTAAATGCAGATTTGG - Intergenic
943145923 2:184044775-184044797 AATTTGTTAAGATGCAGATTTGG + Intergenic
944171663 2:196786218-196786240 ATCTTGTAAAAACGCATATTCGG + Intronic
944513814 2:200490962-200490984 ATCTCTTTAAACTGCAGTTCTGG - Intronic
944692360 2:202169710-202169732 ACCTTGTTAACAGGCAGGTCTGG - Intronic
944793411 2:203157143-203157165 ATCCTGTAAAAAGGCAGGTCTGG - Intronic
945062036 2:205917654-205917676 AACTAGTTAAAATGCAGATTTGG + Intergenic
945121580 2:206462889-206462911 ATCTTATTAAAATATAAATCAGG - Intronic
945448618 2:209967572-209967594 ATCTTTTTAAAATGAGGATGAGG - Exonic
945598089 2:211820495-211820517 ATCTTCTTTAAATAAAGATCTGG - Intronic
946627161 2:221625371-221625393 ATCTTGTTAAATTGAAAATGTGG - Intergenic
946745954 2:222846192-222846214 ATCTTGTGAAAATGCAGATCTGG + Intergenic
947093230 2:226537117-226537139 CTCTTTATAAAATGCAAATCAGG + Intergenic
947959735 2:234225764-234225786 TTCATGTGAGAATGCAGATCAGG - Intergenic
948493172 2:238326960-238326982 ATCTTTCTAAAAAGCACATCTGG + Intronic
948785655 2:240351294-240351316 ATCTTGTTAAAATCCAATCCTGG + Intergenic
948933579 2:241148662-241148684 ATCTTTGTAAAATGCATATCTGG - Intronic
1168974577 20:1954495-1954517 GTCTTGTGAAAATGCAGACTTGG - Intergenic
1169532247 20:6498146-6498168 ATCTTATTACCATGCAGATCTGG - Intergenic
1169970014 20:11259640-11259662 AAGCTGTTAAAAGGCAGATCTGG - Intergenic
1170487436 20:16833070-16833092 ATCATGTTAAAATGCCAATCAGG + Intergenic
1170652718 20:18257377-18257399 ATCTATTTAAAACTCAGATCTGG - Intergenic
1170737644 20:19025484-19025506 ATGTTGTTCAAGTGCAGATTCGG + Intergenic
1170876252 20:20253084-20253106 TTCTTGTTAAAATGCAGATTAGG + Intronic
1170877706 20:20266306-20266328 TTCTTTTCAAAATGCAGTTCTGG - Intronic
1171377662 20:24704414-24704436 ATCATGTTAAAAGGCAGATTAGG + Intergenic
1172268331 20:33636886-33636908 GTCTTGTTAATTTGCAGGTCAGG + Intronic
1172480147 20:35266733-35266755 ATGTTGCTAAAATGCAGATGAGG - Intronic
1173877020 20:46379485-46379507 CTCTTTCTAAAATGCAAATCTGG + Intronic
1174029651 20:47612160-47612182 ATCTTCTTAAAATACAGAGAAGG - Intronic
1174648577 20:52105580-52105602 ATCTCGTTAAAATGCAGACACGG - Intronic
1175076179 20:56375857-56375879 ATGTTGTTAGATTGCAGATATGG + Intronic
1176664220 21:9669493-9669515 ATCCTGTTAAAAGACAGGTCTGG + Intergenic
1176966135 21:15213824-15213846 ATTTTTCTAAAATGCAAATCTGG - Intergenic
1177463970 21:21450031-21450053 ATTTTGTAAAAAGGCAAATCAGG - Intronic
1177502260 21:21972407-21972429 ATCTGGTTAAAATGAAGAAAAGG - Intergenic
1177687491 21:24456978-24457000 ACCTTGTTTAAATGCATATGTGG - Intergenic
1177774322 21:25551066-25551088 ATGCTGTAAAACTGCAGATCAGG + Intergenic
1177781161 21:25623702-25623724 GTCTTGTTAAAATGCAGATTTGG - Intergenic
1177929922 21:27268068-27268090 ATGTTGTTAAAATGTAGGTTCGG - Intergenic
1178076824 21:29019973-29019995 ATCCTGTTGAAGTGCAGATCAGG + Intergenic
1178304252 21:31477709-31477731 ATTTTTTTAAAATTGAGATCAGG + Intronic
1178878236 21:36428944-36428966 CTCTTTCTAAAATGCAGATGAGG - Intergenic
1179412963 21:41176228-41176250 GTCCTGTTAAAATGCAGAATCGG + Intronic
1180238812 21:46484168-46484190 ATCTTGATAAAGTGCGGATTTGG + Intronic
1181691563 22:24565183-24565205 AAATTGTTAAAAAGCAAATCAGG - Intronic
1181830782 22:25558707-25558729 ATCTTGTTCCAGTGCAGATTTGG + Intergenic
1183038060 22:35155158-35155180 GTCTTGTTAAAAAGCCGATGGGG + Intergenic
1184316042 22:43690196-43690218 ATCTTTTAAAAATGTAAATCCGG + Intronic
1184972628 22:48037325-48037347 TTCTTGTTAAAATGCAGATCGGG - Intergenic
1184991924 22:48176248-48176270 AACTTTTCTAAATGCAGATCTGG + Intergenic
949520333 3:4846483-4846505 ATCTGGTTCAAGTGCAAATCAGG - Exonic
949907511 3:8870901-8870923 ATCTTTTAGAAATGTAGATCAGG - Intronic
950313661 3:11980997-11981019 ATCATGTTATAATGCTGACCAGG + Intergenic
950688995 3:14640848-14640870 AGCTTGTTAAATTGTAGAACTGG - Intergenic
950719432 3:14872009-14872031 ATCTTGTCAACAGGCAGATCTGG - Intronic
951501581 3:23393522-23393544 AACTTGTTAAAACACAGATTAGG - Intronic
951871530 3:27367982-27368004 ATCTTTTTAAAACGCACATAAGG - Intronic
952673775 3:36001396-36001418 ATCTTTGCAAACTGCAGATCAGG - Intergenic
953027233 3:39152349-39152371 ACGTTTTTAAAATGCAAATCTGG - Intronic
953762720 3:45703804-45703826 ATCCTGTTAAAATACAGCTAAGG - Intronic
954837377 3:53481534-53481556 ATCTTGTTAAAATGCAGATGTGG - Intergenic
954952030 3:54483912-54483934 ATATTGTTAAATTGAAGTTCTGG + Intronic
955094403 3:55782785-55782807 ATCTTCTCAAGATGCAAATCAGG + Intronic
955154531 3:56403623-56403645 ATCTCGTTAAAATAAAGATTCGG - Intronic
956613437 3:71147235-71147257 ATCTTTTGAAAATGCACATCAGG + Intronic
957202328 3:77152625-77152647 ATCTTGTTGAAAGGAAGATTTGG - Intronic
957456249 3:80451743-80451765 ATTTTATTAAAATGCATATCTGG - Intergenic
957555767 3:81762629-81762651 TTCTTGTTAAAACCCAGAACTGG + Intergenic
957881966 3:86228149-86228171 ATATTGTTCAAATGTAGAACTGG + Intergenic
957954597 3:87168881-87168903 ATCTTTTAAAAATGCAGATTAGG - Intergenic
958762245 3:98323093-98323115 ATCTTGTTAAAATGCATATTTGG - Intergenic
959167439 3:102798278-102798300 ATCTAGATAAAATGCAAATTTGG + Intergenic
959352656 3:105286294-105286316 AGTTTGTTAAAATACAGATTTGG + Intergenic
960266794 3:115629285-115629307 ATCTTTACAAAATGCAAATCGGG + Intronic
960329897 3:116346172-116346194 ATCTTCTTGAAATGGAGATATGG - Intronic
960403708 3:117234458-117234480 AACTTGTTAAAATGCAGAGTGGG + Intergenic
960586658 3:119326315-119326337 ATCTTGTTAAAATTAGGGTCTGG + Intronic
960602318 3:119470273-119470295 ATCTTTAGAAAATGCACATCAGG + Intronic
960902010 3:122563142-122563164 ATATTTCTAAAATGCAAATCTGG + Intronic
961201427 3:125048714-125048736 ATCTTCTTAAAATGTAACTCAGG - Intronic
961546045 3:127634117-127634139 GTCTTTTTAAAATGCAAATCTGG - Intronic
961596022 3:128017398-128017420 GTTTTGTTAAAGAGCAGATCAGG - Intergenic
962040771 3:131705327-131705349 GTCTCCTTAAAATGCAGATTTGG - Intronic
962288195 3:134106245-134106267 ATCTTGTTAAAATGCAGATTGGG + Intronic
962306894 3:134295570-134295592 ATCTTTTCAAAATGTATATCTGG - Intergenic
962732019 3:138292339-138292361 ATCTTTTAAAAATTCAAATCAGG - Intronic
963218225 3:142775260-142775282 AACTTGTTTAAATGAAGATTTGG + Intronic
963267347 3:143252598-143252620 ATCCTGTTAAAATACAGATTCGG - Intergenic
963403436 3:144832473-144832495 AACTTGTTAAACTACAGATATGG + Intergenic
963936022 3:151054503-151054525 ATCCTGTTAAAAAGCAGATTTGG - Intergenic
964128091 3:153257657-153257679 ATCTTTTGAAAATACAGATCTGG + Intergenic
965305148 3:167055189-167055211 ATCCTGTTATAATGCAGAGCTGG + Intergenic
965500353 3:169448285-169448307 ATCTTCTTAAAATCCTGGTCAGG - Intronic
965986042 3:174754256-174754278 ATGTTTTAAAAATGCATATCAGG + Intronic
966296573 3:178430803-178430825 AGCATGTTCAAAGGCAGATCAGG + Intronic
966435623 3:179880809-179880831 AACTTGTTCAAATGCAAATAAGG + Intronic
966630689 3:182071045-182071067 ATATTTTTAAAATGCAGAAGTGG - Intergenic
966664976 3:182462109-182462131 ATTTTTTTGTAATGCAGATCTGG + Intergenic
967445949 3:189566586-189566608 ATCTTGTTACAGTGCAGATTTGG - Intergenic
967818550 3:193819036-193819058 GTCTGGTTAAAATGCCGATGTGG + Intergenic
967985880 3:195095007-195095029 ATCTGGTTAAAATGCAGACTGGG + Intronic
968120901 3:196125224-196125246 ATCTTGTTCAAATGCAGATTCGG - Intergenic
970555129 4:17224077-17224099 ATCTTTTTAAAAATCAAATCTGG - Intergenic
970860259 4:20694398-20694420 ATCTTGGTAGAATGCAAATTTGG + Intergenic
971519377 4:27529953-27529975 CCCTAGTAAAAATGCAGATCAGG - Intergenic
972263562 4:37436815-37436837 AACTTGTTATAATGTAGATAAGG - Intronic
972746370 4:41936032-41936054 ATTTTTTTAAGATGCTGATCTGG + Intronic
972793306 4:42393348-42393370 ATCTTGTTAAAATGCAGATCTGG - Intergenic
974452253 4:62080547-62080569 ATCTTGTTAAAATGCAAATTTGG + Intergenic
974513862 4:62882232-62882254 ATCTTTTTAAAATCAACATCAGG + Intergenic
974693047 4:65325919-65325941 ATCTTGTAAAAATGAAGGGCTGG - Intronic
975060175 4:69986823-69986845 ATAGTGTTAAAATGCAGGTCTGG + Intergenic
975979055 4:80134824-80134846 ATCTTGGGAAAAAGTAGATCAGG - Intergenic
977514410 4:98002544-98002566 ATCTTATTAAAATGAAGATGAGG + Intronic
977925139 4:102692113-102692135 ATTCTTATAAAATGCAGATCTGG - Intronic
978242930 4:106538041-106538063 ATCTTTTTAAAAACCAGCTCCGG + Intergenic
979466563 4:121045733-121045755 AACTTTTTCAGATGCAGATCCGG - Exonic
979587043 4:122432744-122432766 AACTTGTCAAAATGCAGATTTGG - Intergenic
981551853 4:145949804-145949826 AGCTTGTTTAAATGCACAGCCGG + Intergenic
981822527 4:148902461-148902483 ATGTTATTAAAATTCAGAACTGG + Intergenic
982267982 4:153557616-153557638 ATCTTGTTAAATGCCATATCAGG - Intronic
983050552 4:163041483-163041505 ATCTTGTGAATAAACAGATCTGG - Intergenic
984970434 4:185184202-185184224 ATACTGTTAAAATGCAGATTTGG - Intronic
985409683 4:189670172-189670194 ATCCTGTTAAAAGACAGGTCTGG + Intergenic
985548387 5:521146-521168 ATCTTTTTAAAATGCAGAAGGGG - Intronic
986487924 5:8259339-8259361 GGCTTGTTAAGATGCAGATTTGG - Intergenic
987146052 5:14992890-14992912 AGCTTCTTAAAATGCAGACTCGG - Intergenic
987781603 5:22443924-22443946 ATAATTTTAAAATGCAAATCAGG + Intronic
988548478 5:32178875-32178897 AGCTTTTCAAAATGCAAATCTGG - Intergenic
989387690 5:40869556-40869578 ACCTTGTTAAAATGCAGATTAGG + Intergenic
990265818 5:54074135-54074157 AACATGTTATAATCCAGATCTGG - Intronic
990316095 5:54584653-54584675 ATCTTGCTTAAATGCAGGTAGGG + Intergenic
990898379 5:60724242-60724264 TTCCTTTTAAAATGTAGATCTGG - Intergenic
991429121 5:66525586-66525608 ATGTTGTTAAAATGCAAATTTGG + Intergenic
991600186 5:68344201-68344223 ATCTTATTAAAATGCAGATTTGG - Intergenic
992290863 5:75278341-75278363 TTATTGTTAACATGCAGCTCAGG - Intergenic
992424856 5:76646470-76646492 ATCTTGTCAGAATGCAGGTTAGG - Intronic
992490706 5:77241559-77241581 ATGTTGGTAAAATGGAGATAAGG - Intronic
992573782 5:78090053-78090075 ATCTTCTAAAAATGCAAGTCTGG + Intronic
992711298 5:79460155-79460177 ATCTTTCTAAAATGCAAAGCTGG - Intronic
992874961 5:81044711-81044733 AAGTTGTTAAGCTGCAGATCTGG + Intronic
993334481 5:86640803-86640825 ATCTAGTTATTCTGCAGATCAGG + Intergenic
994762292 5:103870250-103870272 ATCTTCATAAAATGCAATTCTGG - Intergenic
994854839 5:105105216-105105238 ATAATGTTAAAATTCAGATATGG + Intergenic
995159564 5:108962842-108962864 AACTGGTTAAGAGGCAGATCTGG + Intronic
995450437 5:112294224-112294246 ATCTGGTTAAAATGAACAGCAGG + Intronic
996066076 5:119080708-119080730 ATCATTTTAAAAGGCAGATTAGG + Intronic
996373482 5:122777278-122777300 ATCTTGTTGAAGTGCAAATTCGG + Intronic
996871280 5:128195952-128195974 TTCTTGTTAAGTTGCAGAGCTGG + Intergenic
997038616 5:130224465-130224487 TCATTGTTAAAATGCAGTTCTGG + Intergenic
997921021 5:137979422-137979444 TTCTTCCTAAAATACAGATCTGG + Intronic
998020609 5:138766797-138766819 TACTTGTGAAAATGCAGCTCTGG + Intronic
999539553 5:152556695-152556717 ATGATGTTAAATTGCAGATGTGG - Intergenic
999808540 5:155106720-155106742 ATCTTGTTAAAATGCAGATTTGG + Intergenic
1000078221 5:157815339-157815361 ATTTTGTTAAAATGTAAATTTGG + Intronic
1000328648 5:160190810-160190832 ATCTTTTAAAAATGCAAATCAGG + Intronic
1000465394 5:161569483-161569505 ATCATGTTAAAATACAGATTTGG + Intronic
1000838570 5:166187318-166187340 TTCTTGTGAAAATGCAAATTTGG - Intergenic
1001490746 5:172153490-172153512 ATCTTGTCAAATTGCACATGGGG + Intronic
1001696201 5:173671919-173671941 ATCCTCTTAAAATACAAATCAGG - Intergenic
1001721442 5:173860214-173860236 ATCTTTCTAAAATGCAAATCCGG - Intergenic
1003011078 6:2428118-2428140 TGCTTGTGGAAATGCAGATCAGG - Intergenic
1003527379 6:6909596-6909618 ATCTTGTTGAAAGGCAGGTCTGG + Intergenic
1003713987 6:8625585-8625607 GTTCTGTTAAAATGCAGAACAGG - Intergenic
1003714977 6:8636050-8636072 ATCTTGATAAAATGCAGATTTGG + Intergenic
1003974003 6:11325836-11325858 AACTTGTTAAAATGAAAATTGGG - Intronic
1004078387 6:12366379-12366401 ATCTTGGTAAAATGCAGATTAGG - Intergenic
1004517506 6:16332912-16332934 ATCTTGTTAAAATGCAGGACTGG - Intronic
1005232765 6:23723358-23723380 ATGTTGTTAAAATGCAATTCTGG + Intergenic
1005366784 6:25086624-25086646 AGTTTGTTAAAAAGCAAATCTGG - Intergenic
1005726972 6:28658852-28658874 CTCTGGATAAAATGCGGATCAGG - Intergenic
1006163687 6:32052523-32052545 TTTTTGTTAAAAAGCAGATTTGG - Intronic
1006164300 6:32055712-32055734 ATCTTGCTAAGAGGCAGATTGGG - Intronic
1006770787 6:36550846-36550868 ATTTGGTTAAAGAGCAGATCTGG + Intergenic
1006866947 6:37216377-37216399 ATTTTTCTAAAATGCAAATCGGG - Intronic
1007261216 6:40564689-40564711 ATCTTTTCAAAATGTAAATCTGG + Intronic
1007832807 6:44651779-44651801 ATCGTGATAAAATGCAGATTTGG + Intergenic
1007883878 6:45203554-45203576 ATCTGTTTGAAATGCAAATCAGG + Intronic
1008292865 6:49739029-49739051 ATGTTGCCAGAATGCAGATCTGG + Intronic
1008831357 6:55766639-55766661 AACTTTTTAAAATGCATATCTGG + Intronic
1010020852 6:71158422-71158444 ATCTTGCTAAAATGCAGATGTGG + Intergenic
1010020945 6:71159156-71159178 ATCTTATTAAAATGCAGATGAGG - Intergenic
1010298523 6:74230306-74230328 ATCTTGCTAAAATGAAGATTTGG + Intergenic
1011379496 6:86727335-86727357 ATGGTGTTAAAATCAAGATCTGG - Intergenic
1011471484 6:87712279-87712301 ATCTTGTTATAATGCAGATTTGG + Intergenic
1011748014 6:90426119-90426141 ATTTTATTAAAATGAAGATGGGG + Intergenic
1012022573 6:93943502-93943524 CATCTGTTAAAATGCAGATCAGG + Intergenic
1012026352 6:93997444-93997466 AGCTTGGTAAACAGCAGATCAGG - Intergenic
1012046868 6:94287152-94287174 ATCCTGTGGAAATACAGATCTGG - Intergenic
1012795386 6:103753629-103753651 ATCTTTTAAAAATACAAATCTGG - Intergenic
1012934275 6:105349435-105349457 ATCTTTTTAAAAAGCACATAGGG - Intronic
1012984518 6:105860808-105860830 ATCTTCTCAAAATGCAGAATAGG - Intergenic
1013333303 6:109128546-109128568 AACTTGTCAAAATGCAAACCTGG + Intronic
1013581719 6:111541685-111541707 ATTTTGTTCACATTCAGATCAGG + Intergenic
1014612741 6:123564609-123564631 ATCTATTTAAAAGGCACATCAGG + Intronic
1015102859 6:129501772-129501794 ATCTTGTGAAAATAGAGAACAGG + Intronic
1015816928 6:137220465-137220487 ATCTTGATAAAATGCAGATTTGG + Intergenic
1015946318 6:138504703-138504725 TTCTAGTTAAAATGCAGCACTGG - Intronic
1016162624 6:140900366-140900388 ATCTGGTTACTATGCAGATGTGG + Intergenic
1018118800 6:160614850-160614872 ATATTGTTAAAATGATAATCAGG - Intronic
1018119401 6:160620402-160620424 ATATTGTTAAAATGATAATCAGG - Intronic
1018120003 6:160625948-160625970 ATATTGTTAAAATGATAATCAGG - Intronic
1018120604 6:160631492-160631514 ATATTGTTAAAATGATAATCAGG - Intronic
1018121200 6:160637041-160637063 ATATTGTTAAAATGATAATCAGG - Intronic
1018121803 6:160642584-160642606 ATATTGTTAAAATGATAATCAGG - Intronic
1018251671 6:161877767-161877789 CTCTTTTTAAAATGCAAATATGG - Intronic
1018623938 6:165759176-165759198 ATCTTTTTAAAATGTAGTTTTGG - Intronic
1019095950 6:169579181-169579203 TTCTTGATAAAATGCAAAGCTGG - Intronic
1020342078 7:7122949-7122971 ATCTTGTTAAAATGCAGAGTTGG + Intergenic
1020701204 7:11485657-11485679 ATCTAGTTCAAAAGCAGATTGGG - Intronic
1021164099 7:17312820-17312842 AGCTTTTTAAAATGCAAATTTGG + Intronic
1021320270 7:19201001-19201023 ATCTTATTAAAATGGAAATTTGG - Intergenic
1021403631 7:20238360-20238382 TCTTTGTTAAAATGCAGATTTGG + Intergenic
1021470078 7:20991866-20991888 ATCTTGAAAAAATGCTGATAAGG - Intergenic
1021540275 7:21749631-21749653 GTTTTGTTAAAATGCTGATGCGG - Intronic
1022279585 7:28893341-28893363 ATATTGTTAAAATGAACATACGG + Intergenic
1022526112 7:31038410-31038432 ATATTTTTAAAATGCAAATGAGG + Intergenic
1022802098 7:33786482-33786504 AACTTGTCAAAACCCAGATCTGG - Intergenic
1022813983 7:33896333-33896355 ATCTTGTTAAAATGCCGATTTGG + Intergenic
1022922132 7:35026299-35026321 ATCTTGTTAAAATGTGGATTGGG - Intronic
1023165651 7:37341062-37341084 ATCTTGTTAAAATGCAGACTTGG + Intronic
1023678883 7:42662945-42662967 ATCTTCCTAAAATACAAATCTGG - Intergenic
1023971456 7:44994237-44994259 ATCTAGCAAAAATGCAAATCTGG + Intergenic
1024686409 7:51750740-51750762 ATCCTGTTAAAATGTACTTCAGG + Intergenic
1026107088 7:67429858-67429880 AGCTTGTTAAAACACAGATCAGG - Intergenic
1026612416 7:71871865-71871887 ATTATGGTAAAAAGCAGATCTGG - Intronic
1026954563 7:74368910-74368932 ATATTTTTAAAATGTAAATCAGG + Intronic
1027247721 7:76378646-76378668 ATCTTTTAAAAATTCAAATCTGG + Intergenic
1027572127 7:79882772-79882794 AACTTGTTAACTTGCAAATCAGG + Intergenic
1027573189 7:79897867-79897889 GACTTTTTAAAATGCAGATTGGG - Intergenic
1027678246 7:81186288-81186310 ACTTTGTGAAAATGCAGATTTGG + Intronic
1027958415 7:84912726-84912748 ATTTTGTTAAATTGCTGATATGG - Intergenic
1029633333 7:101767264-101767286 ATCTTTTTAAAATAGAGATGAGG - Intergenic
1029726033 7:102405225-102405247 ACCTTGTTAAAATACAGATGCGG - Intronic
1030224248 7:107130971-107130993 ATCTTGTTAAAATGCAGATTTGG + Intronic
1030350422 7:108478690-108478712 ATCCTTTTAAAATGCAAATTAGG - Intronic
1030413719 7:109213624-109213646 ATCTTTGTAACCTGCAGATCAGG - Intergenic
1030573856 7:111261942-111261964 ATCTTTTTAAAAGCCAAATCTGG - Intronic
1030604436 7:111624467-111624489 ATCTTGTTAAAATTCTTGTCTGG - Intergenic
1030670388 7:112329012-112329034 ATCTTGCTAGAAGGCACATCTGG - Intronic
1031107908 7:117568324-117568346 ATCTTTGTAAAATGCAAATCTGG - Intronic
1031361364 7:120852579-120852601 ATCTTGTTAAAATGCAGATTTGG - Intronic
1031593645 7:123623293-123623315 ATCTTATTAAAATACAGATTAGG - Intronic
1032587280 7:133158696-133158718 ATCTTTTTAAAATGCAAGTATGG + Intergenic
1032706925 7:134428620-134428642 ATCTTTTTAAAATGGATATATGG + Intergenic
1033518510 7:142134663-142134685 ATCTTGCAAAAATGCATATTTGG - Intronic
1033599558 7:142878862-142878884 ATCTTCTTAAACTGCAGATTTGG - Intronic
1036611265 8:10351789-10351811 ATCTTGGTAAAATGCAGATTCGG + Intronic
1036676921 8:10841697-10841719 ATCATGTTAAAATGCACATCTGG + Intergenic
1037098701 8:15016902-15016924 CTCTTTTTAACAAGCAGATCTGG + Intronic
1038568501 8:28639438-28639460 ATCTTTTGAAAATGTAAATCTGG + Intronic
1039195221 8:35023678-35023700 ATCTTTGTAAAATGTAAATCAGG + Intergenic
1039355259 8:36808529-36808551 ATCTTGTACCAATGCAGATTGGG + Intronic
1041653038 8:60320014-60320036 ATCTTGTTAAAAAGCAGATTTGG + Intergenic
1042054473 8:64749380-64749402 ATCTTTCTAAAATACAAATCTGG - Intronic
1042927981 8:73986315-73986337 AACATGTTAAAATACAGCTCAGG - Intergenic
1043981224 8:86641994-86642016 TTCTTGTTACAATGCAGATTTGG + Intronic
1044354275 8:91202796-91202818 ATATTGTTAAAATGTAAATTAGG - Intronic
1044506736 8:93029159-93029181 AACTTTCTAAAATGCACATCTGG - Intergenic
1044755377 8:95456154-95456176 ATCTTGCTCAAATGCATATCCGG - Intergenic
1044940801 8:97341476-97341498 CTCATTTTAAAATGCAAATCTGG + Intergenic
1045764714 8:105653566-105653588 ATCTTGTTAAAATGCACATATGG - Intronic
1045964770 8:108012359-108012381 ATCTTGTTCAAAAGCAGATTTGG - Intronic
1046303023 8:112323075-112323097 ATCTGGTTAAAATGCTTTTCAGG + Intronic
1048314531 8:133352372-133352394 ATCTTTTTCAAAAGCAAATCTGG - Intergenic
1049294395 8:141823414-141823436 AACTTTCTAAAATCCAGATCTGG + Intergenic
1049434435 8:142579883-142579905 ATCTTGTTAAAATGCACCCTGGG + Intergenic
1049602004 8:143512300-143512322 CTGTTGATAAAAAGCAGATCAGG - Intronic
1049987579 9:966065-966087 ATCTTGTTACTATACAGATCTGG - Intronic
1051310133 9:15761536-15761558 ATCTTGTTAAAATGCACATTAGG - Intronic
1051572880 9:18580902-18580924 CTCTTGCTAAAATACAGATTTGG + Intronic
1051682104 9:19617820-19617842 ATCTTCTTAAAAAGTAAATCAGG - Intronic
1052090857 9:24325559-24325581 ATCTTGTCAAAAAGCATTTCAGG + Intergenic
1054154570 9:61631190-61631212 ACCTGGTTAAAATACAGATTCGG - Intergenic
1054855048 9:69890087-69890109 ATCATTTTAAAATGCATTTCAGG + Intronic
1055305381 9:74924000-74924022 CTCTTCCTAAAATGCAGATTGGG + Intergenic
1055357460 9:75452036-75452058 ATCTGGTTACACTGCAGAGCTGG - Intergenic
1055612417 9:78036699-78036721 ATCTTGATAAAATTCAGAATGGG - Intergenic
1055620460 9:78120032-78120054 ATTTATTTAAAATGCACATCAGG + Intergenic
1055730872 9:79278280-79278302 ATCTTGTTAAAATGGGGCCCCGG + Intergenic
1055772836 9:79736002-79736024 AACTTTTTACAATGCAGATTGGG + Intergenic
1056110713 9:83391947-83391969 ATTTTGCCAAAATGCAGACCAGG - Intronic
1056125043 9:83527659-83527681 CTCTTGTTCAAATGCAGACTCGG - Intronic
1056290879 9:85142768-85142790 ATCCTGTCAACATGCACATCTGG - Intergenic
1056933133 9:90895293-90895315 GTCTTGTTAAAGTGCAGATATGG + Intronic
1056972483 9:91218483-91218505 TCCTTGTTAAAATGCAGATGTGG + Intronic
1058321088 9:103631944-103631966 ATCTTCCTAAAATACAGATTTGG + Intergenic
1059025271 9:110621136-110621158 AATTTTTTAATATGCAGATCTGG + Intergenic
1059519210 9:114924180-114924202 AGCTTGTTAAAATGCAGATTCGG + Intronic
1060149083 9:121276038-121276060 ATCTTGTGAAAATCCAGATTTGG - Intronic
1060405839 9:123372753-123372775 ATCTTTGTAAAATGCAGATCTGG - Intronic
1060459887 9:123841459-123841481 ATCTTCTTAATATTGAGATCTGG + Intronic
1060993126 9:127860300-127860322 ATCTTGTGAAAACGCAGGTTCGG - Intergenic
1061706075 9:132454282-132454304 ATCTATTTAAAAATCAGATCAGG + Intronic
1203661881 Un_KI270753v1:52259-52281 ATCCTGTTAAAAGACAGGTCTGG - Intergenic
1203673073 Un_KI270755v1:35308-35330 ATCCTGTTAAAAGACAGGTCTGG - Intergenic
1186860036 X:13663870-13663892 ATCCTGTCAAAATGCAGATTCGG - Intronic
1186864792 X:13708907-13708929 ATTTTGTTACCATGCAGATTTGG + Exonic
1187032418 X:15501619-15501641 ATCTTGCTAAAATGAAGATTTGG + Intronic
1187232805 X:17438555-17438577 AACTTGTTCAAATGCAGTTTAGG - Intronic
1187336026 X:18382575-18382597 ATCTTGGCCAAATGCATATCGGG - Intergenic
1187388239 X:18867973-18867995 CTCTTGATAAAATGCAGATTCGG - Intergenic
1187398383 X:18937801-18937823 ATCTTATTAAAAGGCAAATTAGG - Intronic
1187417711 X:19107210-19107232 ATCTTGTTAAAATGCATATGCGG - Intronic
1187579884 X:20596316-20596338 ATCTTGCGAAACTGCAGGTCTGG + Intergenic
1187664404 X:21588654-21588676 ATCTTGTTAAAAAGAAAACCTGG + Intronic
1187688612 X:21841067-21841089 ATCTTGCTAAGATGCAGATTCGG - Intronic
1187704030 X:21991661-21991683 ATCTTGTTAAAATGTAGATTTGG - Intronic
1187747905 X:22429833-22429855 GTATGGTTAAAATGAAGATCAGG + Intergenic
1188308305 X:28586160-28586182 GTCTTGTTAAAATGCAGATTCGG - Intergenic
1188358686 X:29225446-29225468 ATCTTGTTAAACTGCAAATTCGG + Intronic
1188364078 X:29292927-29292949 ATTTTGTAAAACTGCACATCAGG + Intronic
1188996712 X:36895564-36895586 GTTTTGCTAAAATGCAAATCAGG - Intergenic
1189274163 X:39772669-39772691 ATTTTGTTAAGATGCAGATTCGG - Intergenic
1189351932 X:40281979-40282001 ATCTTCTTAAAACGCAGATTTGG - Intergenic
1190436591 X:50431726-50431748 ATTTGGTTAAAATGCAACTCCGG + Intronic
1191126146 X:56956066-56956088 ATTTTGTTATAGTGCAGATTAGG - Intergenic
1192478223 X:71462179-71462201 ATCTTTCTAAAATGTAAATCTGG - Intronic
1193432458 X:81425452-81425474 ATCTTGTTAAATTACAGAGCAGG + Intergenic
1194277333 X:91901363-91901385 ATCTTGGTAAAATTCCAATCAGG - Intronic
1194720311 X:97333271-97333293 TCCTTGATAAAATGGAGATCAGG - Intronic
1194921486 X:99771640-99771662 ATCTTAATAAAATGAACATCTGG + Intergenic
1197379019 X:125715270-125715292 ATCTAGTTAATGTGCAGCTCAGG - Intergenic
1197689023 X:129477251-129477273 ATCTTTTAAAAATGTAAATCTGG + Intronic
1197714529 X:129696930-129696952 ATCGCATTAAAATGCAGATTTGG + Intergenic
1197851734 X:130869287-130869309 GTCTTTCTAAAATGCAAATCTGG + Intronic
1198229811 X:134678132-134678154 ATATTTTGAAAATGCAAATCAGG + Intronic
1198665928 X:139022744-139022766 ATCATTTTAAAAGGCAGATGTGG + Intronic
1198716070 X:139558858-139558880 ATCCTTATAAAATGCAGATCTGG - Intronic
1198734319 X:139769802-139769824 ATCTTCTTAAACTGCAAATTCGG + Intronic
1198808684 X:140513045-140513067 ATCTTTTTAAAATACAGTTAAGG + Intergenic
1198840639 X:140853625-140853647 GTCTTTTTAAAAAGCAAATCAGG - Intergenic
1199463268 X:148107340-148107362 CTCTGATTAAAATGCAGATCGGG - Intergenic
1200594673 Y:5123460-5123482 ATCTTGGTAAAATTCCAATCAGG - Intronic
1202025579 Y:20519327-20519349 ATCTTGCTCAAAAGCAGAGCAGG + Intergenic