ID: 909480290

View in Genome Browser
Species Human (GRCh38)
Location 1:76123049-76123071
Sequence TTAATGTGCAGAGGAATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909480290_909480296 10 Left 909480290 1:76123049-76123071 CCAGTGATTCCTCTGCACATTAA No data
Right 909480296 1:76123082-76123104 GTTTTGCTGGCTGGGCACGGTGG No data
909480290_909480292 -3 Left 909480290 1:76123049-76123071 CCAGTGATTCCTCTGCACATTAA No data
Right 909480292 1:76123069-76123091 TAATGTTTAAGAAGTTTTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 360
909480290_909480293 1 Left 909480290 1:76123049-76123071 CCAGTGATTCCTCTGCACATTAA No data
Right 909480293 1:76123073-76123095 GTTTAAGAAGTTTTGCTGGCTGG No data
909480290_909480295 7 Left 909480290 1:76123049-76123071 CCAGTGATTCCTCTGCACATTAA No data
Right 909480295 1:76123079-76123101 GAAGTTTTGCTGGCTGGGCACGG 0: 1
1: 1
2: 15
3: 142
4: 893
909480290_909480294 2 Left 909480290 1:76123049-76123071 CCAGTGATTCCTCTGCACATTAA No data
Right 909480294 1:76123074-76123096 TTTAAGAAGTTTTGCTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909480290 Original CRISPR TTAATGTGCAGAGGAATCAC TGG (reversed) Intronic
No off target data available for this crispr