ID: 909480293

View in Genome Browser
Species Human (GRCh38)
Location 1:76123073-76123095
Sequence GTTTAAGAAGTTTTGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909480290_909480293 1 Left 909480290 1:76123049-76123071 CCAGTGATTCCTCTGCACATTAA No data
Right 909480293 1:76123073-76123095 GTTTAAGAAGTTTTGCTGGCTGG No data
909480289_909480293 26 Left 909480289 1:76123024-76123046 CCAGATCTGCATTTTAACAAGAT 0: 2
1: 12
2: 41
3: 96
4: 412
Right 909480293 1:76123073-76123095 GTTTAAGAAGTTTTGCTGGCTGG No data
909480291_909480293 -8 Left 909480291 1:76123058-76123080 CCTCTGCACATTAATGTTTAAGA 0: 1
1: 0
2: 4
3: 40
4: 266
Right 909480293 1:76123073-76123095 GTTTAAGAAGTTTTGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909480293 Original CRISPR GTTTAAGAAGTTTTGCTGGC TGG Intronic
No off target data available for this crispr