ID: 909480532

View in Genome Browser
Species Human (GRCh38)
Location 1:76125174-76125196
Sequence GAAACCTTGTTGGCTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909480532_909480536 9 Left 909480532 1:76125174-76125196 CCAGGAGCAGCCAACAAGGTTTC No data
Right 909480536 1:76125206-76125228 GAATCCATATTTAGAGTCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909480532 Original CRISPR GAAACCTTGTTGGCTGCTCC TGG (reversed) Intronic
No off target data available for this crispr