ID: 909481205

View in Genome Browser
Species Human (GRCh38)
Location 1:76130364-76130386
Sequence GAGCCATTCTTACCTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909481205_909481211 -7 Left 909481205 1:76130364-76130386 CCAGTTTCAGGTAAGAATGGCTC 0: 1
1: 0
2: 0
3: 11
4: 112
Right 909481211 1:76130380-76130402 ATGGCTCTCCATGGGGTGGGTGG No data
909481205_909481217 10 Left 909481205 1:76130364-76130386 CCAGTTTCAGGTAAGAATGGCTC 0: 1
1: 0
2: 0
3: 11
4: 112
Right 909481217 1:76130397-76130419 GGGTGGCTGTGGGGGCACAGTGG 0: 1
1: 0
2: 13
3: 111
4: 933
909481205_909481213 0 Left 909481205 1:76130364-76130386 CCAGTTTCAGGTAAGAATGGCTC 0: 1
1: 0
2: 0
3: 11
4: 112
Right 909481213 1:76130387-76130409 TCCATGGGGTGGGTGGCTGTGGG 0: 1
1: 1
2: 2
3: 35
4: 371
909481205_909481215 1 Left 909481205 1:76130364-76130386 CCAGTTTCAGGTAAGAATGGCTC 0: 1
1: 0
2: 0
3: 11
4: 112
Right 909481215 1:76130388-76130410 CCATGGGGTGGGTGGCTGTGGGG 0: 1
1: 0
2: 0
3: 57
4: 468
909481205_909481216 2 Left 909481205 1:76130364-76130386 CCAGTTTCAGGTAAGAATGGCTC 0: 1
1: 0
2: 0
3: 11
4: 112
Right 909481216 1:76130389-76130411 CATGGGGTGGGTGGCTGTGGGGG 0: 1
1: 0
2: 4
3: 90
4: 856
909481205_909481212 -1 Left 909481205 1:76130364-76130386 CCAGTTTCAGGTAAGAATGGCTC 0: 1
1: 0
2: 0
3: 11
4: 112
Right 909481212 1:76130386-76130408 CTCCATGGGGTGGGTGGCTGTGG 0: 1
1: 0
2: 3
3: 88
4: 525
909481205_909481210 -10 Left 909481205 1:76130364-76130386 CCAGTTTCAGGTAAGAATGGCTC 0: 1
1: 0
2: 0
3: 11
4: 112
Right 909481210 1:76130377-76130399 AGAATGGCTCTCCATGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909481205 Original CRISPR GAGCCATTCTTACCTGAAAC TGG (reversed) Intronic
902700167 1:18167012-18167034 GAACCGTCTTTACCTGAAACAGG + Intronic
902738217 1:18415205-18415227 CTGCCATTCTTCCCTGAAGCGGG + Intergenic
909481205 1:76130364-76130386 GAGCCATTCTTACCTGAAACTGG - Intronic
914384943 1:147159483-147159505 GAACCAGTCTTACCTGAGACTGG - Exonic
914940041 1:152014449-152014471 CATCCATTCTTACATTAAACAGG + Intergenic
915400547 1:155618685-155618707 GAGGGATTGCTACCTGAAACCGG - Intergenic
915418072 1:155757691-155757713 GAGGGATTGCTACCTGAAACCGG - Intronic
918624896 1:186646195-186646217 GAGCCACACTTACCTGTAAATGG + Intergenic
919230479 1:194766475-194766497 GAACGATAGTTACCTGAAACCGG + Intergenic
919989730 1:202701526-202701548 AAGACATTCTTAACTGAAAATGG + Intronic
920149401 1:203892362-203892384 GAGCCCTTCATACCAGATACAGG + Intergenic
921925301 1:220706067-220706089 GAGCCATGCTCAGCTGACACAGG + Intergenic
922632426 1:227129960-227129982 GAGCCATGGTTACCTGTAGCTGG - Intronic
923233552 1:232010943-232010965 CAGCCATTCTTTCCTGAAGCAGG - Intronic
923892431 1:238230362-238230384 AGGACATTCTTACGTGAAACTGG - Intergenic
1069201729 10:65627389-65627411 AAGACATTCTTAGGTGAAACAGG + Intergenic
1075018731 10:118931298-118931320 GAGGTTTTCTTACCTCAAACTGG + Intergenic
1080317158 11:30963292-30963314 GAGCAATTCATATCTGCAACTGG + Intronic
1081333206 11:41830174-41830196 GAGGCATTCTCACGTGAAATGGG - Intergenic
1081351857 11:42064041-42064063 GAGCCATCCTAACCAGAAAATGG + Intergenic
1081522436 11:43895848-43895870 TAGACATTCTTAAATGAAACTGG - Intronic
1089398070 11:118148726-118148748 GAGACATTCTTGGCTGACACTGG - Intronic
1091453423 12:587655-587677 GAGCCATTCTTCCCTGCCCCGGG + Intronic
1096860976 12:54527913-54527935 GAGCCTGTCTTACCTGACAGAGG + Intronic
1100664055 12:96731215-96731237 GGGGCATTCTTAAGTGAAACTGG - Intronic
1102388047 12:112527416-112527438 GATCCAGTCATACCTGAAACTGG - Intergenic
1103482415 12:121259458-121259480 AAGCCATTCTGACCTGGATCTGG + Intronic
1103506796 12:121446409-121446431 GAGATATTCTTAGATGAAACTGG - Intronic
1106937241 13:34736521-34736543 GGGACATTCTTAAGTGAAACTGG - Intergenic
1107375896 13:39803857-39803879 GAGACATTGTTACCAGAAAGGGG - Intergenic
1111497549 13:89071703-89071725 AAGCAATTCTGACATGAAACAGG + Intergenic
1125282729 15:38059667-38059689 GAGCCATTGATACCTAAAAGTGG + Intergenic
1127217332 15:56837415-56837437 GAGCCATTCTTTCCTTTAAAAGG + Intronic
1127356344 15:58204571-58204593 GATACATTCTTGCCTTAAACTGG + Intronic
1127587448 15:60392082-60392104 GAGCCATACCCACCTCAAACTGG + Intronic
1127639485 15:60902444-60902466 GAGCCATTCTCACGTGTAAATGG - Intronic
1128550264 15:68593856-68593878 GAGCCATCCTGACCTGAGAAGGG + Intronic
1129415682 15:75377315-75377337 GAAACATTCTTAAGTGAAACTGG - Intronic
1129508102 15:76099771-76099793 GAACTATTCTTACCTGAGACTGG + Intronic
1135092944 16:19535930-19535952 GTGCTTTTCTAACCTGAAACAGG - Exonic
1138951446 16:61918128-61918150 AAGACACTCTTACGTGAAACTGG - Intronic
1143897046 17:10144478-10144500 GATCCTTTCTTACCTGATACTGG - Intronic
1146009885 17:29185412-29185434 GAGCTCTTCTTGCCTGAACCAGG + Intergenic
1149468695 17:56899180-56899202 GAGCCCTTCTTCTCTGACACAGG - Exonic
1150039620 17:61845860-61845882 AAGACATTCTTAAATGAAACTGG + Intronic
1150566714 17:66348270-66348292 GAGACTTTCTTAAATGAAACTGG + Intronic
1152607823 17:81301891-81301913 CAGGCATTCTTTCCTGAAGCAGG - Intergenic
1154394630 18:13975780-13975802 CAGAAATTTTTACCTGAAACAGG + Intergenic
1156942656 18:42789058-42789080 AAGACATTCTTAAGTGAAACTGG + Intronic
1157169944 18:45393957-45393979 GAGCCATTTAGACCTGAATCTGG - Intronic
1159943886 18:74429322-74429344 GAGGCTTTCTTTCCTGAGACAGG + Intergenic
1164580735 19:29433428-29433450 GAGCCAGTCCTTCCTGAACCCGG + Intergenic
928662126 2:33513411-33513433 GTCCCATTCTTACCTTCAACAGG - Intronic
929065508 2:37969813-37969835 GAGCCTTTCAAACCTGAAAAAGG - Intronic
929579327 2:43071662-43071684 GAGGCATTCTCACCAGAACCTGG - Intergenic
930518866 2:52437887-52437909 GGGCCAATCTTTACTGAAACAGG + Intergenic
931276773 2:60750864-60750886 GAGCCCTTCTTTCCTGAAAAAGG + Intergenic
936591181 2:113806225-113806247 TAGGCATTCTTGCCTCAAACTGG - Intergenic
937901094 2:127019758-127019780 GAGCCAATCTTAACTAAATCTGG - Intergenic
941076139 2:161008616-161008638 AAGACATTCTTAAGTGAAACTGG - Intergenic
942519855 2:176792002-176792024 GAGCTATTTTTGCCTGAAACAGG + Intergenic
945654880 2:212611157-212611179 GAGCCATTCTTATCAGGAAATGG - Intergenic
945698982 2:213147458-213147480 TAACCTTTCTTACCTGATACAGG + Intronic
946532784 2:220590402-220590424 GAGTCATTCTTTCCTAAAAGAGG - Intergenic
946589963 2:221234885-221234907 TAGCCATTCTTCTCTAAAACTGG - Intergenic
948043395 2:234923146-234923168 GAGCCATAGTGACCTCAAACTGG + Intergenic
1169167540 20:3437157-3437179 CAGACATTCTCACCTGACACAGG + Intergenic
1172319068 20:33982247-33982269 GAGCCATTCTTACCAGTCACAGG + Intergenic
1179315329 21:40238835-40238857 CAGTCATTCTCACCTGAAAGTGG - Intronic
1183114977 22:35684951-35684973 GAACCAACCTTACCTGAAGCAGG - Intergenic
1183181883 22:36265758-36265780 GAGCCAATCTCAGCTGAAAGCGG + Exonic
949641403 3:6039087-6039109 GATATATGCTTACCTGAAACTGG + Intergenic
960829304 3:121829429-121829451 GAGCCACTCTTACCAGAGAATGG - Intronic
965170049 3:165251383-165251405 GTGCCCTTCTTCCCTGAACCAGG - Intergenic
965174604 3:165315837-165315859 ATGCCATTCTTAACAGAAACAGG - Intergenic
967457703 3:189708237-189708259 GAGACATTGTTTGCTGAAACTGG - Intronic
967552344 3:190811167-190811189 GAGCCTATCCTACCTGAAAGAGG - Intergenic
968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG + Intronic
969157817 4:5227815-5227837 GTGCCATTCTTAAGTGAAATTGG + Intronic
970832962 4:20365222-20365244 GAACCATTCTTAACTGATACGGG - Intronic
971325085 4:25636919-25636941 GAGCCATCCTTCCCAGAAAGAGG - Intergenic
971669353 4:29536296-29536318 CATCCCTTCTTCCCTGAAACTGG - Intergenic
973334320 4:48940857-48940879 GAGCTAGTCATTCCTGAAACAGG - Intergenic
974227359 4:59064186-59064208 GAGCCATTCTTGACTACAACAGG + Intergenic
981548908 4:145922529-145922551 AAGACATTCTTAAGTGAAACTGG - Intronic
985333579 4:188868215-188868237 GACCCATCCATACCTGAACCTGG - Intergenic
985884214 5:2663843-2663865 GATCCATTCTTATCTGAGAAGGG - Intergenic
986598734 5:9449992-9450014 CAGCCATTGTTATCTAAAACAGG - Intronic
986948352 5:13051306-13051328 GAGCCTTAATTAACTGAAACTGG - Intergenic
989521272 5:42403480-42403502 GAGCCATTTCTGCCTGACACTGG - Intergenic
993390161 5:87310946-87310968 AAGACATTCTTAACTGGAACTGG - Intronic
994753716 5:103769351-103769373 GAGCCACTCTTGGCTAAAACAGG + Intergenic
995842834 5:116460220-116460242 GAGCCTTCCTTACTTGAAAGTGG + Intronic
996573288 5:124956449-124956471 GAGCAGTTCAGACCTGAAACTGG + Intergenic
997804601 5:136904858-136904880 AAGCCATGCTTAGCTGAAGCAGG - Intergenic
1000485331 5:161835086-161835108 GAGCCACGTTTGCCTGAAACTGG + Intergenic
1000841938 5:166230913-166230935 GAGCCAGTCTTGACTGAAACAGG - Intergenic
1005651578 6:27889970-27889992 ATGCCATTTTTAACTGAAACGGG - Intergenic
1010057110 6:71579321-71579343 GAGCAGTTCTTACCAGAAGCTGG - Intergenic
1013604827 6:111738252-111738274 GAACCATGCCTACCTGAAACAGG + Intronic
1015082961 6:129250651-129250673 GTACCTTTCTTACCTAAAACAGG - Intronic
1018341824 6:162858877-162858899 CACCCCTTCTTCCCTGAAACAGG - Intronic
1018877406 6:167835575-167835597 AAGACATTCTTAAGTGAAACTGG + Intronic
1030540684 7:110826904-110826926 AAGGCATTCTTAAGTGAAACTGG + Intronic
1035693624 8:1576665-1576687 TAGCCATACGTAGCTGAAACTGG - Intronic
1035883736 8:3269618-3269640 GAGCCATTTTTCCCTGGGACTGG + Intronic
1036284272 8:7430060-7430082 CAGCCCATCTTACCTGGAACAGG + Exonic
1036337204 8:7881470-7881492 CAGCCCATCTTACCTGGAACAGG - Exonic
1039604250 8:38867679-38867701 GAGCCATTGTTACCTGGAGGGGG + Intergenic
1044441111 8:92225039-92225061 GAGCAATTTTCAGCTGAAACAGG - Intergenic
1044583492 8:93846067-93846089 GAGCCATGCTTATCTGCAAGGGG + Intergenic
1044732618 8:95242560-95242582 AGGACATTCTTAACTGAAACTGG + Intergenic
1046837237 8:118815910-118815932 GATTCATTCTTACTTCAAACAGG + Intergenic
1048191472 8:132293584-132293606 GACTCATTCTCACGTGAAACTGG - Intronic
1050794011 9:9513960-9513982 CAGCCTTTCTGGCCTGAAACTGG - Intronic
1051161369 9:14212098-14212120 GAACCATTCTAACATGAAAGAGG + Intronic
1053381704 9:37654342-37654364 GAGCCAGTCTTGCCTGGAGCTGG + Intronic
1062235250 9:135504914-135504936 GTGCCCGTCTTTCCTGAAACTGG - Intergenic
1188068387 X:25689670-25689692 GAGCCACTCTAAGCTGACACTGG + Intergenic
1189733590 X:44047242-44047264 GAGGTATTGTTACCTGAAAGGGG - Intergenic
1191673263 X:63768911-63768933 GATACATACATACCTGAAACTGG - Intronic
1192169825 X:68847234-68847256 GAGCCATTCTCCTTTGAAACAGG + Intergenic
1194856969 X:98942803-98942825 AAGCCATTCTTAGATAAAACTGG - Intergenic
1199915556 X:152336301-152336323 GAGCCATTGTGAGCTGAAGCAGG - Intronic