ID: 909486156

View in Genome Browser
Species Human (GRCh38)
Location 1:76176565-76176587
Sequence ATCTATAAGCTAATGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909486156_909486161 6 Left 909486156 1:76176565-76176587 CCCACCAGCATTAGCTTATAGAT 0: 1
1: 0
2: 0
3: 4
4: 100
Right 909486161 1:76176594-76176616 GAGGATTAAACATGACTTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909486156 Original CRISPR ATCTATAAGCTAATGCTGGT GGG (reversed) Intronic
901811742 1:11771345-11771367 ATTTAAAAGCTATTGCTGGGGGG - Intronic
903444340 1:23411667-23411689 AGTTATAAGATAATGCTGTTTGG + Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
915059016 1:153164398-153164420 ATCTCTAATCCAATGCTGATGGG + Intergenic
915921262 1:159977544-159977566 ATCCTTCAGCTACTGCTGGTAGG + Intergenic
917369167 1:174270164-174270186 TTCTCTAAGGTCATGCTGGTTGG + Intronic
920824115 1:209409281-209409303 ATCTATAAGTTAAGGGTGGGTGG - Intergenic
921081058 1:211738697-211738719 AGACATAAGCTAAAGCTGGTGGG - Intergenic
924304142 1:242670104-242670126 ATCTAAAAGCTAGTTCTGTTTGG + Intergenic
1064247174 10:13678235-13678257 CTGTATCCGCTAATGCTGGTTGG + Intronic
1064894492 10:20219085-20219107 ATCTAAAAGATAATGGAGGTAGG + Exonic
1067009906 10:42701234-42701256 ATCTATAAGCAAGTCCTGTTGGG - Intergenic
1067959549 10:50832997-50833019 ATCTATCAGCTAATGATACTGGG - Intronic
1069094716 10:64244645-64244667 ATCTATAAGAAAATGCAGGCCGG - Intergenic
1070667022 10:78352197-78352219 ATCTCTTAGATAATGGTGGTTGG + Intergenic
1072428984 10:95354658-95354680 ATTTATAAGCTAGTGCCTGTGGG + Intronic
1075629532 10:123992474-123992496 CTCTATAGGCTGCTGCTGGTTGG - Intergenic
1076030652 10:127155064-127155086 GTTTATAAGCTAATGCAGATGGG - Intronic
1081018872 11:37917692-37917714 ATCTATAACCAAATTCTTGTTGG + Intergenic
1085249330 11:75131843-75131865 ATCTATCCGCTTATCCTGGTGGG - Intronic
1086990948 11:93303526-93303548 ACCTGTAAGCTGATGCTGCTTGG - Intergenic
1087846641 11:102980981-102981003 ATATAAAAGATAATGCAGGTTGG + Intergenic
1089471947 11:118728430-118728452 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1094758862 12:33504373-33504395 ATGTATATTCTACTGCTGGTAGG + Intergenic
1095550079 12:43425984-43426006 ACCTATAAGATAATGTTGGCAGG + Intronic
1097331292 12:58335171-58335193 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1097732268 12:63141784-63141806 ATCTATAGGCAAATGATAGTAGG - Intergenic
1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG + Intergenic
1099205876 12:79725805-79725827 ATTTATAAGAATATGCTGGTTGG - Intergenic
1104825936 12:131709894-131709916 CTCTTAAAGCTAATTCTGGTGGG + Intergenic
1106211851 13:27656505-27656527 ATTTATAATCTAATGGGGGTGGG + Intronic
1109077864 13:57861121-57861143 ATCATGAAGCTAATGCTGGAAGG - Intergenic
1109891855 13:68624794-68624816 AGCTCTTAGTTAATGCTGGTGGG + Intergenic
1111007238 13:82263854-82263876 ATCTTAAAGCTAATGCAGTTTGG - Intergenic
1114331658 14:21643026-21643048 ATCTAATAGCAAATGCTGCTGGG + Intergenic
1116787490 14:49303621-49303643 ATCTCTAAGCTGATGGGGGTTGG + Intergenic
1116894407 14:50301962-50301984 ATCACTAAGCAAATGCTAGTTGG + Intronic
1117563904 14:56974110-56974132 TTCAATAATATAATGCTGGTAGG - Intergenic
1118525851 14:66641620-66641642 TTCTATCAGCTATTGATGGTTGG - Intronic
1125166670 15:36714310-36714332 ATGTATAATCTTATGTTGGTCGG + Intronic
1128821896 15:70664140-70664162 ATTTAGAAGCTAATGTTGGAAGG - Intronic
1133013342 16:2927017-2927039 ATTGATAAGCTAATGGCGGTTGG - Intronic
1142794996 17:2300783-2300805 ATCCAAATGCTAATACTGGTAGG + Intronic
1143492030 17:7290251-7290273 CTCTATAGGCTGCTGCTGGTTGG + Exonic
1149744221 17:59079358-59079380 ATCTCTAAGAAAATGCTGGCAGG + Intronic
1150324582 17:64246543-64246565 ATATTTAAGACAATGCTGGTAGG - Intronic
1153564729 18:6408368-6408390 ATTTATAAGCTCTTGCTGGTGGG - Intronic
1158888893 18:61855030-61855052 TTAAATAAGCTAATGGTGGTGGG + Intronic
1160356858 18:78235398-78235420 ATTTATCAGCAAAAGCTGGTTGG - Intergenic
1161730601 19:5958456-5958478 ATCTCTAAGTGAGTGCTGGTTGG + Intronic
1161753877 19:6117277-6117299 CTTTATGAGCTAATGCTGCTAGG - Intronic
1165536685 19:36453547-36453569 ATCTATTAGCAAATGATTGTAGG - Intronic
1166382406 19:42361935-42361957 ATCTATTACCAAATGGTGGTGGG + Intronic
1168500562 19:56889442-56889464 ATCCATCAGCAAATCCTGGTTGG + Intergenic
926377472 2:12248077-12248099 ATCTGTAAGTTAAAGATGGTTGG - Intergenic
928476964 2:31637447-31637469 ATTTATAAACTGTTGCTGGTGGG - Intergenic
929873246 2:45775416-45775438 ATGAATAAGCTCTTGCTGGTGGG - Intronic
931257793 2:60588895-60588917 AGCTATAAGCTAATGAAGGTTGG - Intergenic
937007138 2:118527477-118527499 ATCCATTTTCTAATGCTGGTTGG + Intergenic
937080661 2:119137424-119137446 ATCTATAAGCAAATGGGGGGAGG - Intergenic
937647303 2:124280007-124280029 TTCTAGAAGCAAATGCTGGATGG - Intronic
939018161 2:136926130-136926152 ATATACAAGCAAATGCAGGTAGG - Intronic
945819878 2:214650945-214650967 ATAAATTAGCTAAAGCTGGTTGG + Intergenic
947305947 2:228747518-228747540 TTTTATAAGCTAAGTCTGGTGGG + Intergenic
1169757573 20:9059746-9059768 ATATATAAGGTAAACCTGGTGGG + Intergenic
1184029035 22:41880253-41880275 GTCTAAAAGCTACTGCTGGCCGG + Intronic
950030927 3:9852858-9852880 ATTGATAAGCTACTGGTGGTTGG + Intronic
951451184 3:22840464-22840486 AACTCTTAGCTATTGCTGGTGGG + Intergenic
952181989 3:30926609-30926631 ATCTCTTAGCTAATGGTGTTTGG + Intergenic
952626743 3:35415034-35415056 ATCTACTAGCAAAAGCTGGTGGG - Intergenic
957831333 3:85524592-85524614 ATGTATAATCTACTGCTGTTGGG + Intronic
966316606 3:178654022-178654044 ATCTATAACCTAAAGCTTCTAGG - Intronic
974194460 4:58554038-58554060 ATCTATAACCTAAAGCATGTTGG - Intergenic
976465572 4:85364774-85364796 GCCTCTAAGCTAATGATGGTGGG - Intergenic
978246746 4:106581360-106581382 ATCTTTGATCTAATGCTGATGGG + Intergenic
983215339 4:164997395-164997417 ATTGATAAGCTACTGGTGGTTGG - Intergenic
984213527 4:176879830-176879852 ATTAATAAGCTAATGCTAATAGG - Intergenic
991982430 5:72246639-72246661 ATCTTTAATTTAGTGCTGGTAGG + Intronic
993777249 5:92014613-92014635 ATCCAAAAGCTATTGCTGATTGG - Intergenic
993839026 5:92853064-92853086 ATGTATAAGGGAATGATGGTGGG + Intergenic
995335964 5:111000167-111000189 ATGTAACAGCTAATGCTTGTTGG - Intergenic
997931949 5:138080024-138080046 ATGTATAAGATAATTCTGGCCGG + Intergenic
998762286 5:145445854-145445876 AAATATTAGCAAATGCTGGTGGG + Intergenic
999966596 5:156816835-156816857 ATCTAGAAGCAAATCCTAGTTGG - Intergenic
1000060718 5:157652628-157652650 ACCTATTAGCTAATGTTGCTGGG + Intronic
1000948277 5:167449129-167449151 ATGTAAAAGCTAAAGCTTGTAGG + Intronic
1004482418 6:16033454-16033476 TTTTATAAGGTCATGCTGGTGGG - Intergenic
1018876070 6:167824311-167824333 GTCAATAAACTAATGTTGGTTGG + Intergenic
1020998810 7:15301140-15301162 ATTTAAAAGCAAATGCTGGCCGG + Intronic
1030081228 7:105780256-105780278 ATCCAGATGCTGATGCTGGTTGG - Intronic
1031402818 7:121345760-121345782 ATTTAAAAGCAAATGATGGTTGG - Intergenic
1036590583 8:10164397-10164419 TTCTCCAAGCTAATGCTGTTCGG + Intronic
1042046490 8:64658141-64658163 ATCTATAAGGTAATGATGTTAGG - Intronic
1043020267 8:74991430-74991452 CTTTATAAGCTAATCATGGTGGG - Intronic
1045720985 8:105110655-105110677 ATCTCTCATCTATTGCTGGTGGG - Intronic
1055545329 9:77365257-77365279 ATATAGAAGATAATGCTTGTTGG + Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1059614750 9:115937189-115937211 ATATAGAAGCTGATGCAGGTGGG + Intergenic
1059629676 9:116107426-116107448 ATCAATAAGCTACTCCTGGCAGG + Intergenic
1187250132 X:17590261-17590283 ATCTAAAAGCTTATGCTAGGTGG + Intronic
1199440088 X:147857918-147857940 ATCTATCAGCTTTTGCTGGCTGG - Intergenic
1199446268 X:147926077-147926099 ATGTATAAACTAAAGCTTGTAGG - Intronic
1201643822 Y:16205611-16205633 CTCTCTAAACTAATCCTGGTTGG - Intergenic
1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG + Intergenic
1202092307 Y:21206489-21206511 ATTTATAAGTTAATCTTGGTAGG - Intergenic