ID: 909486161

View in Genome Browser
Species Human (GRCh38)
Location 1:76176594-76176616
Sequence GAGGATTAAACATGACTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909486158_909486161 2 Left 909486158 1:76176569-76176591 CCAGCATTAGCTTATAGATACAC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 909486161 1:76176594-76176616 GAGGATTAAACATGACTTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 197
909486156_909486161 6 Left 909486156 1:76176565-76176587 CCCACCAGCATTAGCTTATAGAT 0: 1
1: 0
2: 0
3: 4
4: 100
Right 909486161 1:76176594-76176616 GAGGATTAAACATGACTTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 197
909486157_909486161 5 Left 909486157 1:76176566-76176588 CCACCAGCATTAGCTTATAGATA No data
Right 909486161 1:76176594-76176616 GAGGATTAAACATGACTTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909486161 Original CRISPR GAGGATTAAACATGACTTTC TGG Intronic
902541554 1:17159132-17159154 GAGAATTAATCATGGCTTTGTGG + Intergenic
903706422 1:25289111-25289133 GAGGATTAAAATGGACTTTTTGG - Intronic
903720815 1:25404255-25404277 GAGGATTAAAATGGACTTTTTGG + Intronic
907059168 1:51403724-51403746 GAGGATTAAAGATGACCTGAAGG - Intronic
909486161 1:76176594-76176616 GAGGATTAAACATGACTTTCTGG + Intronic
909512180 1:76465841-76465863 AAGGATAAATCATGACGTTCTGG + Intronic
909584421 1:77273440-77273462 GAGGAGTAAATATGATTTTATGG - Intergenic
910227480 1:84950823-84950845 GAGGTTTAATCATAACTTACAGG - Intronic
911815722 1:102347363-102347385 GAGCTTTGAAGATGACTTTCAGG + Intergenic
913183092 1:116341829-116341851 GGGGGTTTAACATGAATTTCGGG - Intergenic
915693316 1:157712592-157712614 AAGAATCAAACATGATTTTCAGG - Intergenic
917798383 1:178548464-178548486 GAGAATTAAACAGGGCTTTGAGG - Intronic
918359880 1:183746233-183746255 GATGATTAAACACAACTTTCAGG - Intronic
919310450 1:195900233-195900255 GAGAAATAAACTTGACTTTTTGG + Intergenic
921079945 1:211731121-211731143 GAGGTGTAAACATGAATTTTAGG - Intergenic
921951303 1:220932908-220932930 GAGAATGAAACCTGCCTTTCTGG - Intergenic
1063963921 10:11330081-11330103 GAGGATAAAGCATGAACTTCAGG - Intronic
1066705987 10:38178512-38178534 GAGGATTTAACATAACATTAAGG - Intergenic
1067371002 10:45682421-45682443 GAGGATTTAACATAACATTAAGG - Intergenic
1067417286 10:46113228-46113250 GAGGATTTAACATAACATTAAGG - Intergenic
1067591890 10:47519897-47519919 GAGGATTTAACATAACATTAGGG + Intronic
1067639005 10:48027970-48027992 GAGGATTTAACATAACATTAGGG + Intergenic
1067874476 10:49992325-49992347 GAGGATTTAACATAACATTGAGG - Intronic
1068737175 10:60427229-60427251 TAGGAGTAAACATTTCTTTCTGG + Intronic
1070135995 10:73694133-73694155 GAGGATTTAACATAACATTAAGG + Intronic
1070685986 10:78481616-78481638 GTGTATTAATCATGACTCTCTGG - Intergenic
1072057942 10:91779190-91779212 GATGATTATACACCACTTTCAGG + Intergenic
1072999283 10:100274453-100274475 GAGGATAAATGATGACTGTCTGG + Intronic
1073306474 10:102506729-102506751 GAGGAATATAAATGAATTTCAGG - Intronic
1079946356 11:26746832-26746854 GAGGATTAAAGGTGAAATTCTGG - Intergenic
1080144886 11:28969624-28969646 GAGGAGTCAAAATGACTTCCAGG - Intergenic
1080793703 11:35543640-35543662 TAGGATTAAACATGTCTTACTGG - Intergenic
1081625208 11:44651373-44651395 GAGGATCATACCTGTCTTTCTGG - Intergenic
1082172960 11:49027955-49027977 GGGGATTACACATAACTTTTAGG - Intronic
1083050916 11:59775773-59775795 GAAGATTTAACAAGACCTTCAGG + Intronic
1085142831 11:74163989-74164011 TAGGAATATACATGACTTTGCGG - Intronic
1087938756 11:104067246-104067268 GAGGATCAAACAAGACCTTGAGG + Intronic
1088200668 11:107330061-107330083 AGGGATTAAACATAACTTTCTGG - Intronic
1088916752 11:114233314-114233336 GAGGATTAAAAACCACATTCCGG - Intronic
1090174155 11:124632840-124632862 TAGGATTTAACATGAATTTTGGG + Exonic
1091541020 12:1462683-1462705 GAGGATAAAACAGAACCTTCTGG + Intronic
1092096100 12:5843180-5843202 CAGTCTTCAACATGACTTTCTGG - Intronic
1092182472 12:6455266-6455288 GGGGTTTAAACATGCGTTTCGGG - Intronic
1092392792 12:8096122-8096144 GAGGAATAAAAATGACCTTGAGG + Exonic
1095342947 12:41113731-41113753 GAGGATTAAGAATGATTCTCTGG - Intergenic
1096374444 12:51096654-51096676 GAGGATTCAAAATGATTTTTTGG + Intronic
1096673878 12:53216053-53216075 GAGGATTAAACATGTCATATAGG - Intronic
1096785226 12:54013449-54013471 GAGGATTGAATGTGAATTTCAGG - Intronic
1097589470 12:61556577-61556599 GAGCATAAAACATAACTTTTGGG - Intergenic
1097767865 12:63546105-63546127 GAGGATTAAAAATGCCTTCATGG - Intergenic
1097784228 12:63741167-63741189 GAGGATTAAAAATGCCTTCATGG - Intergenic
1099285048 12:80707130-80707152 AAAGGTTATACATGACTTTCAGG - Intergenic
1100155649 12:91797110-91797132 CAGGGTTGAACATGACTTTAGGG - Intergenic
1106953195 13:34907234-34907256 GAGGATAAATTATGACTTTATGG - Intergenic
1107334523 13:39339890-39339912 GAGGACGAAACAGGACTTTCTGG - Intergenic
1108969871 13:56360593-56360615 GAGAATTAAAGAAGACTTCCAGG + Intergenic
1108982233 13:56530265-56530287 GAGGATGAAACACCAGTTTCTGG - Intergenic
1111252307 13:85618470-85618492 AAGGAAGAAACATGTCTTTCAGG + Intergenic
1111514665 13:89313590-89313612 GAGGATTATACTTCATTTTCAGG - Intergenic
1115958075 14:38804695-38804717 AAGTTTTAAACATGTCTTTCTGG - Intergenic
1117649527 14:57888410-57888432 AAGGATGAAACCTGTCTTTCTGG - Intronic
1120852572 14:89184699-89184721 GAGGCTTAAACATACCTTGCAGG + Intronic
1122243629 14:100384954-100384976 GAGAATTAAACATGCCTCGCTGG + Intronic
1129630994 15:77260217-77260239 TAGGCTTAAACATTCCTTTCAGG - Intronic
1130884283 15:88080612-88080634 GAGGACCAAACATCACTTACAGG + Intronic
1133095462 16:3442282-3442304 TAGGATTAAAAGTGACTTTCTGG - Intronic
1133950577 16:10388306-10388328 GAGAAATAACCATGACTTTTTGG + Intronic
1134428417 16:14176918-14176940 GAGGAACAGACCTGACTTTCAGG + Intronic
1135783150 16:25323986-25324008 AAGAATTAAAGGTGACTTTCAGG + Intergenic
1136555527 16:31005606-31005628 GAGGATTAAACAAGAGATGCAGG - Intronic
1138303883 16:55956857-55956879 GAGGATTGAAAACGACTATCTGG + Intergenic
1138824047 16:60297456-60297478 GTAGATTAAATAGGACTTTCTGG - Intergenic
1140967395 16:79980250-79980272 GATGATTTAGCATGACTTCCTGG + Intergenic
1141826829 16:86486495-86486517 GAGGGTTAAACATGATGTGCCGG + Intergenic
1144190088 17:12837683-12837705 GAGGGTTAACAATGACTTTCTGG + Intronic
1146575401 17:33986709-33986731 GAGGGTTAAATATGAATTTATGG - Intronic
1149023305 17:51995540-51995562 AAGGATTTAATATAACTTTCAGG - Intronic
1149773292 17:59338277-59338299 GAGGCTCAAACATGATCTTCTGG + Intronic
1150009285 17:61489744-61489766 GAGGACTTAACATCTCTTTCTGG - Intergenic
1150562663 17:66307389-66307411 TAGGCTTGAACATGACTTTAGGG + Intronic
1151057604 17:71051652-71051674 GAGAATTTAGCATGACTCTCAGG + Intergenic
1154139741 18:11812541-11812563 GAACATTAAAAATGACATTCAGG + Intronic
1155117673 18:22785367-22785389 GTAGTTTAAACATGCCTTTCAGG + Intergenic
1156002990 18:32406407-32406429 GAGAATACAACATGACATTCTGG + Intronic
1156805758 18:41178319-41178341 GAAGATGAAACATGGCTTTATGG + Intergenic
1157023451 18:43814758-43814780 GCTGATTAAACATCACTTTTAGG + Intergenic
1157075599 18:44463697-44463719 AAGAATTGAACATGACTTTTTGG + Intergenic
1158565041 18:58547686-58547708 GTGGGTAAAACAAGACTTTCTGG - Intronic
1163051144 19:14684724-14684746 GAGAATTAAACATTACTGCCAGG - Intronic
1163952967 19:20607843-20607865 GAAGATTAAAAATGTCTTTTGGG - Intronic
1163961753 19:20703011-20703033 GAAGATTAAAAATGTCTTTTGGG + Intronic
1164746742 19:30621982-30622004 GAAGATTAAAAATAAGTTTCTGG + Intronic
927392583 2:22611858-22611880 AAGGTTGAAACATGACTTTCAGG + Intergenic
929339411 2:40795544-40795566 AATGCTAAAACATGACTTTCTGG - Intergenic
930512285 2:52359816-52359838 GAGGATTTAGCTTGGCTTTCAGG + Intergenic
930564974 2:53007214-53007236 GAGGATTAAAGATAACATACTGG + Intergenic
933585825 2:84178408-84178430 GAGGATTAAACAAGAGTTGTGGG + Intergenic
935178523 2:100670379-100670401 ATGGATTAAACATTACTTCCGGG - Intergenic
935254238 2:101294794-101294816 AAGTATTCAACATGACTTTTTGG - Intronic
936144265 2:109969077-109969099 GAGGAATAAAACTGTCTTTCTGG + Intergenic
936180947 2:110267037-110267059 GAGGAATAAAACTGTCTTTCTGG + Intergenic
936200424 2:110402392-110402414 GAGGAATAAAACTGTCTTTCTGG - Intergenic
937748497 2:125444798-125444820 GTGGATTAAACATAATTTTTAGG - Intergenic
941584101 2:167335532-167335554 GTGGATTATTCATGAGTTTCCGG + Intergenic
941598644 2:167510637-167510659 GAGTATCAAAGATGATTTTCAGG + Intergenic
945189116 2:207167550-207167572 GAATATTAAACATGAATTACTGG + Intergenic
945252145 2:207772686-207772708 GTGGATTATTCATGAGTTTCCGG - Intergenic
945768409 2:214009163-214009185 GAGGATTCACCATGAATTTTGGG - Intronic
948222725 2:236286006-236286028 TGAGATTAAACATCACTTTCAGG - Intergenic
1169356728 20:4913033-4913055 GAGAATTACAAATGGCTTTCGGG - Intronic
1169755310 20:9037072-9037094 CAGTATTATCCATGACTTTCAGG + Intergenic
1178188755 21:30256156-30256178 GATGGTAAAACATTACTTTCTGG - Intergenic
1180241485 21:46509955-46509977 GAGGATTAGACATAGCTTTCAGG + Intronic
1182768386 22:32775342-32775364 GAGGCTTCAACATGAATTTTGGG + Intronic
1183833624 22:40434334-40434356 AAGAATTAATCATGATTTTCTGG + Intronic
1184225081 22:43124987-43125009 GTGGATTATTCATGAGTTTCCGG + Intronic
949333458 3:2947855-2947877 GAGAATTAAACTTGCCTTTTAGG + Intronic
949796906 3:7861263-7861285 GAGGATTAAAGAACACTTCCTGG + Intergenic
952368143 3:32693094-32693116 TAGCATTTAACATGGCTTTCTGG - Intronic
953684058 3:45062218-45062240 ATGGATTATTCATGACTTTCCGG - Intergenic
955192866 3:56778034-56778056 GTGGATTAAACATGACCCTTGGG - Intronic
956981219 3:74640950-74640972 GAGGAATATTCATGTCTTTCTGG + Intergenic
959728939 3:109578229-109578251 GAGGATGAAAAATTACTTTATGG - Intergenic
960076154 3:113487831-113487853 GAGGACTTAACATCACTTTAGGG + Intronic
960217567 3:115060662-115060684 GAAAATTAAACATGACTATATGG + Intronic
960896170 3:122507992-122508014 GAAGATTAAAATTGAATTTCTGG - Intronic
962899255 3:139744181-139744203 CAGGTTTAAACATCACTTTCTGG - Intergenic
963151084 3:142045998-142046020 GAGGATTAAAGATCCCTTTGAGG + Intronic
969587049 4:8100104-8100126 GATGAATCAACATCACTTTCTGG + Intronic
970430407 4:15983842-15983864 GAGGATTAAGCCTGACTAACTGG + Intronic
971572944 4:28236651-28236673 GAGGAATAAAAATGACTCCCTGG + Intergenic
971913688 4:32830777-32830799 TAGGTTGAAACATTACTTTCTGG - Intergenic
972218631 4:36926611-36926633 CAAGATTTAAAATGACTTTCTGG - Intergenic
974232965 4:59140538-59140560 GAAGATTAAAGATGGCTTTTTGG + Intergenic
974489954 4:62551906-62551928 GAGGATTAAACAAGTTTTACTGG + Intergenic
975111227 4:70629310-70629332 GAAGATTAAACTTGATTTTGTGG + Intronic
976013479 4:80520775-80520797 GCACATTAAACAAGACTTTCTGG + Intronic
976895589 4:90106782-90106804 AAGGTTTACACATGGCTTTCAGG + Intergenic
977282090 4:95052991-95053013 GAGAATAAAAAATGACTCTCAGG - Intronic
977397475 4:96488799-96488821 TAGGATTAAACAAGTCTTACTGG - Intergenic
977441122 4:97069781-97069803 GATGATTAAAAATGGGTTTCAGG - Intergenic
978229238 4:106378328-106378350 AATAATTAAACATGACTTCCAGG - Intergenic
980979725 4:139643987-139644009 GAGGATGAAAAATTACTTACTGG - Intergenic
981101086 4:140829747-140829769 GAGGCTTAAACTGGACTTTGAGG + Intergenic
982024190 4:151235482-151235504 GAGGATAAAACATTTCTTACAGG + Intronic
985786354 5:1897360-1897382 GTGGATGACACCTGACTTTCTGG + Intergenic
987726511 5:21707641-21707663 GAAGATAAAGCATGACTTACTGG - Intergenic
988016947 5:25571621-25571643 GAGGTTTTAACATGACTTTAAGG - Intergenic
988832196 5:34998864-34998886 GAGAATCAAATATGACTTTGAGG + Intronic
988833384 5:35008440-35008462 GAGGAGTATAGATAACTTTCAGG + Intronic
989078166 5:37587014-37587036 GAGGAGAAAACATTACTTTGAGG - Intronic
990650962 5:57899014-57899036 CAGGCTTCAACATGACTTGCTGG - Intergenic
992996116 5:82335440-82335462 AAGAAATAAACATGTCTTTCTGG - Intronic
993251959 5:85538600-85538622 GATCATTAAACATGCTTTTCAGG - Intergenic
994571155 5:101515698-101515720 GGGGTTTAAACATGCATTTCGGG - Intergenic
995424930 5:112010472-112010494 GAGGAAAAAACATGACTGTAAGG + Intergenic
995748987 5:115434187-115434209 GAGGACTGAGCATGACTGTCAGG - Intergenic
998478863 5:142444850-142444872 GAGGATTCAACAGGACTTAGTGG - Intergenic
1001631626 5:173179648-173179670 GAGGTTTGAACACGACTTTGAGG - Intergenic
1002240829 5:177838354-177838376 GAGGATTAAGCTTCACCTTCTGG + Intergenic
1005713791 6:28527599-28527621 TAGGATTAAACTAGACTTCCTGG - Intronic
1008783339 6:55135203-55135225 CAGGATTAAAAATGACTTTGAGG + Intronic
1010310789 6:74383244-74383266 AAAGATTAAAAATGACCTTCGGG + Intergenic
1010940054 6:81906238-81906260 GAGGATTAAACATGTTTACCTGG - Intergenic
1011125539 6:84003281-84003303 GGGGATGAAAAATGATTTTCTGG + Intergenic
1011529696 6:88308220-88308242 GAAGATTAAACATTCTTTTCAGG - Intergenic
1013485519 6:110592735-110592757 GAGGCTTAAGCAGGACTTTTGGG + Intergenic
1013663069 6:112318168-112318190 GAGAATTAAAAATGATTTACCGG - Intergenic
1014562020 6:122902352-122902374 GAGGATGAAAAATAAGTTTCAGG - Intergenic
1015580446 6:134718720-134718742 GAGGATTATACAGGACTGACAGG - Intergenic
1015672867 6:135710153-135710175 GAGGAATGAACATGTTTTTCGGG + Intergenic
1016616236 6:146051781-146051803 GATGATTAAAGATGATTCTCAGG - Intronic
1017519911 6:155193102-155193124 CAGTATTAAAAATTACTTTCAGG + Intronic
1020415645 7:7942771-7942793 GAGAAGTCAACCTGACTTTCTGG - Intronic
1020903792 7:14039618-14039640 GAGGATTAAACATAATTTTAAGG + Intergenic
1021655062 7:22866399-22866421 CAGGATTACACATGACCTTGGGG - Intergenic
1028155952 7:87429590-87429612 GAGGATTCAACATGTCATTATGG + Intronic
1030545277 7:110886573-110886595 GAAGATAAAAGATGACTTACCGG + Exonic
1031500662 7:122511211-122511233 GAAGATTAACCATGTCTTTGGGG - Intronic
1031540491 7:122989234-122989256 GAGGATGGCACATGACTTTCAGG - Intergenic
1032381710 7:131491096-131491118 AAGGATTTCACGTGACTTTCAGG - Exonic
1032902275 7:136323312-136323334 GAGGCTAAAACATGACTGGCTGG + Intergenic
1033385103 7:140865886-140865908 GAGGATCAAACATTTTTTTCTGG + Intronic
1036974991 8:13400403-13400425 CAGCATTATACCTGACTTTCTGG - Intronic
1037090975 8:14918363-14918385 ATGGATTAAACACAACTTTCTGG + Intronic
1037196861 8:16200988-16201010 GAGGATTAAACATTCCTTCCTGG - Intronic
1038926369 8:32144445-32144467 GACGATGAAACAAGAATTTCTGG - Intronic
1039312574 8:36333808-36333830 GAGAATTAAATATGACTTCTTGG + Intergenic
1039928968 8:41965577-41965599 GATGATCAAAGATGACTTCCAGG - Intronic
1039929277 8:41969403-41969425 GATGATCAAAGATGACTTCCAGG - Intronic
1042350615 8:67773497-67773519 GAGAATCAAAAATAACTTTCAGG - Intergenic
1043773154 8:84230419-84230441 CATGATTAAACAGAACTTTCTGG + Intronic
1044889639 8:96819827-96819849 GGAGATGAAACATGGCTTTCCGG - Intronic
1045328008 8:101131121-101131143 AAGGATTAAAAATTAATTTCTGG + Intergenic
1048028874 8:130612420-130612442 GAGGATTATAGGAGACTTTCTGG + Intergenic
1050657335 9:7843347-7843369 GAGGATTGACCTTGATTTTCAGG + Intronic
1052513218 9:29448113-29448135 GAGGAGTAAAGATGAGTCTCTGG - Intergenic
1053334952 9:37259351-37259373 CTTGATTAATCATGACTTTCTGG + Intronic
1053578659 9:39379764-39379786 GAGGATTAAATATGAGCTGCTGG - Intergenic
1053843181 9:42207843-42207865 GAGGATTAAATATGAGCTGCTGG - Intergenic
1054100242 9:60938568-60938590 GAGGATTAAATATGAGCTGCTGG - Intergenic
1054121640 9:61214195-61214217 GAGGATTAAATATGAGCTGCTGG - Intergenic
1054586103 9:66968314-66968336 GAGGATTAAATATGAGCTGCTGG + Intergenic
1058705529 9:107634989-107635011 CGGGATTAGATATGACTTTCAGG + Intergenic
1188069672 X:25703715-25703737 GAGGATAACAGATCACTTTCAGG - Intergenic
1188637388 X:32451245-32451267 GTGTATTAAACAAGACTTCCAGG + Intronic
1189506757 X:41618752-41618774 GAGGATAAAACATGATTTTGTGG - Intronic
1194851695 X:98878272-98878294 GATGAATAAACATGAAGTTCTGG + Intergenic
1196348032 X:114690148-114690170 GAGGATAAAGGCTGACTTTCTGG - Intronic
1197140392 X:123111360-123111382 GATGATTAAACATTCTTTTCAGG - Intergenic
1198591714 X:138190342-138190364 GTGGATTAAACTGGACTTTAGGG + Intergenic
1200324935 X:155227480-155227502 TAGAATTAAACTTGACTTTTGGG - Intronic
1201665459 Y:16448508-16448530 GAACATTAAACATCACTTCCAGG + Intergenic