ID: 909486254

View in Genome Browser
Species Human (GRCh38)
Location 1:76177855-76177877
Sequence TTCATCACTCTTGAGTGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909486249_909486254 -4 Left 909486249 1:76177836-76177858 CCAGCCGTGCTCCACGGATTTCA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 909486254 1:76177855-76177877 TTCATCACTCTTGAGTGACGGGG 0: 1
1: 0
2: 0
3: 6
4: 118
909486250_909486254 -8 Left 909486250 1:76177840-76177862 CCGTGCTCCACGGATTTCATCAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 909486254 1:76177855-76177877 TTCATCACTCTTGAGTGACGGGG 0: 1
1: 0
2: 0
3: 6
4: 118
909486246_909486254 25 Left 909486246 1:76177807-76177829 CCTAACGGGCTTTGGTAATCATT 0: 1
1: 0
2: 0
3: 6
4: 48
Right 909486254 1:76177855-76177877 TTCATCACTCTTGAGTGACGGGG 0: 1
1: 0
2: 0
3: 6
4: 118
909486248_909486254 -3 Left 909486248 1:76177835-76177857 CCCAGCCGTGCTCCACGGATTTC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 909486254 1:76177855-76177877 TTCATCACTCTTGAGTGACGGGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909486254 Original CRISPR TTCATCACTCTTGAGTGACG GGG Intronic
901868227 1:12121726-12121748 TTCATTCCTCTTGAGTGCCTAGG - Intronic
904302470 1:29563253-29563275 TTCCTCACTCTTGAGAGAAATGG + Intergenic
906819948 1:48918863-48918885 TGCATCTCTCTTGAGTGGCCAGG + Intronic
909023304 1:70455892-70455914 TTCATCACTGTTGAGTCAAGTGG - Intergenic
909486254 1:76177855-76177877 TTCATCACTCTTGAGTGACGGGG + Intronic
910683410 1:89890919-89890941 GTCATCACTCTGGAGTGCAGTGG + Intronic
911567320 1:99478097-99478119 TTCATCACTATTGAATAATGAGG - Intergenic
912130290 1:106591099-106591121 TTCATCACTCGTGAGAGGCAAGG - Intergenic
913182534 1:116336105-116336127 TCCACCACTCTTCAGTGAGGAGG + Intergenic
916853080 1:168723934-168723956 TTCATAACTCTAGAGTGTCTAGG + Intronic
917115441 1:171598738-171598760 ATCACAACTCTTGAGTGACTAGG - Intergenic
917670390 1:177268378-177268400 TTCATTACTCTTGAGAGAGGTGG + Intronic
923637732 1:235717901-235717923 TTTTTCACTCTGGAGTGAAGTGG + Intronic
924847579 1:247788575-247788597 TTCACCACTCATGAGAGACAAGG - Intergenic
1063721466 10:8586214-8586236 TTCATCACAGTTCAGTGAGGAGG - Intergenic
1064518050 10:16171279-16171301 TTCATCACTTATGAGAGGCGAGG - Intergenic
1067040180 10:42947462-42947484 TTCAGCACCCTTGAGGGATGGGG + Intergenic
1068220340 10:54036629-54036651 ATCAGAACTCTTGAGTGACCAGG - Intronic
1068559262 10:58494790-58494812 ATCAGTACTCTTGAGTGACCAGG - Intergenic
1071481335 10:86067339-86067361 TCCACCACTTTTGAGTCACGAGG + Intronic
1071971249 10:90909648-90909670 TCCATCAGTCTTGGGTGACCAGG - Intergenic
1074649897 10:115509245-115509267 TTCAAAGCTCTTGAGTGACTAGG - Intronic
1079946581 11:26750359-26750381 TTCATCTCTCTAGAGTGTTGGGG - Intergenic
1084739013 11:71126410-71126432 ATCAGCACTCTTGAGTGACCAGG - Intronic
1085367095 11:75958918-75958940 ATCAGCACTCTTGGGTGACCAGG + Intronic
1085374123 11:76042574-76042596 TCCATCACTGTTGAGTGCAGTGG - Intronic
1086003326 11:82005424-82005446 CTCATCACTATTGAATGAAGAGG - Intergenic
1087557325 11:99737707-99737729 TTCATAACTCTTGTGTGAAATGG - Intronic
1097843769 12:64345849-64345871 TTCATCGCTCATGAGAGACAAGG - Intronic
1098805059 12:75013013-75013035 TTCATCACTCGTGAGAGGCAAGG + Intergenic
1107490075 13:40873296-40873318 TTCACCACTCTTGAGAGGCAAGG + Intergenic
1109292754 13:60496590-60496612 TTCATCACTCATGAGAGGCAAGG + Intronic
1110368429 13:74714100-74714122 TTCAGAGCTCTTGAGTGACTGGG + Intergenic
1113942172 13:114024012-114024034 TTCATCCACCTGGAGTGACGGGG - Intronic
1116855612 14:49949617-49949639 CTCATCACTCTTGAGTTCAGTGG - Intergenic
1118978221 14:70695487-70695509 TTCATCCTTCTTAAGTTACGTGG - Intergenic
1120577547 14:86202098-86202120 ATCATAGCTCTTGAGTGACTAGG - Intergenic
1120588490 14:86346301-86346323 GTCATTAATCTTGAGTGAGGAGG - Intergenic
1121188412 14:91998758-91998780 ATTAGCACTCTTGAGTGACCCGG - Intronic
1126164259 15:45640780-45640802 TTCATCCCTGTTGTGTGACTGGG + Intronic
1129432810 15:75513331-75513353 TTTATCACACTTCAGTGAAGAGG + Intronic
1133572392 16:7054277-7054299 TTCATCATGCTGGAGTGCCGTGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1147165334 17:38590156-38590178 CACATCCATCTTGAGTGACGAGG + Intronic
1150912278 17:69400739-69400761 ATCAGCACTCTTGGGTGACCAGG - Intergenic
1153131668 18:1860741-1860763 TTCATCACTCCTGAGAGGCAAGG - Intergenic
1153218109 18:2838667-2838689 TTCATCACTCCTGAGAGGCAAGG - Intergenic
1153701351 18:7697117-7697139 TTTATCACTATTGAATGTCGGGG + Intronic
1158525916 18:58213624-58213646 CTCATCACTGGTGAGTGACTTGG - Intronic
1158716096 18:59881143-59881165 TTCATCAGTGTTGTGTGACTTGG - Intergenic
1164117733 19:22238381-22238403 TTTATCACTCTTGAGAGGCAAGG - Intergenic
926810796 2:16753741-16753763 TTCATCGCTCATGAGAGACAAGG - Intergenic
928318889 2:30267570-30267592 TTGTTCATTCTTGAGGGACGTGG - Intronic
929832441 2:45358025-45358047 TTCATCTCTCATGAGTGGTGAGG - Intergenic
931232396 2:60385881-60385903 TTCATCACCCTTGAGCTATGAGG - Intergenic
935564700 2:104593297-104593319 TTCATCACTCATGAGAGGCAAGG - Intergenic
938662680 2:133503868-133503890 TTCTTCACTCTTGACTGATTTGG - Intronic
939677778 2:145093875-145093897 TTCACCACTCATGAGAGGCGAGG - Intergenic
941361996 2:164562795-164562817 TTCATCACTCTCCAGTGCCCTGG - Intronic
943509090 2:188802225-188802247 TTCATCACTCATGAGAGGCAAGG + Intergenic
943985734 2:194615541-194615563 ATCATCACTCTTCAGGGACCAGG + Intergenic
945267290 2:207903006-207903028 TTCATGGCTCTTGAGTGCTGTGG + Intronic
946307762 2:218865843-218865865 CTCATCACTCTTGGGAGAGGTGG - Intronic
946790531 2:223296688-223296710 TTCACCACGCTTGAGGGGCGAGG + Intergenic
1169214440 20:3785269-3785291 TCCCTCACTCTTGAGGGAAGTGG + Exonic
1170782836 20:19440913-19440935 TTCATCACATATGAGTGACAGGG + Intronic
1170800642 20:19587315-19587337 CTCATCACTCATTAGTAACGCGG + Intronic
1170904483 20:20500905-20500927 TTCAGAGCTCTTGAGTGATGAGG + Intronic
1172102333 20:32492799-32492821 TTCTCCACTCTTGGGTGACTGGG - Intronic
1173313287 20:41919887-41919909 ATCAACACTCTTGGGTGACCAGG + Intergenic
1173356241 20:42293498-42293520 TTCAACACACTGGAGTGACCTGG + Intronic
1173605708 20:44329855-44329877 CTGATAACTCTTGAGTGACCTGG - Intergenic
1181596358 22:23917467-23917489 TCCATCACTCAAGAGTGAAGAGG + Intergenic
949419624 3:3851963-3851985 TTCATCACTGATAAGTGATGAGG + Intronic
951966235 3:28388797-28388819 TCCTTCATTCTTGAGTGATGTGG + Intronic
957174956 3:76795975-76795997 ATCAGAACTCTTGAGTGACTAGG + Intronic
957282608 3:78172802-78172824 TTCATCACTTTTTATTCACGTGG + Intergenic
960495119 3:118363828-118363850 TTCATCACTCATGAGAGGCAAGG - Intergenic
964948703 3:162260653-162260675 ATCAGAACTCTTGAGTGACCAGG - Intergenic
965251871 3:166352715-166352737 TTCACCACTCATGAGTGGCAAGG - Intergenic
965583288 3:170292337-170292359 TTCATGACTCTGGAGTCACATGG - Intronic
965676528 3:171203101-171203123 TTAACCACCCTTGTGTGACGTGG - Intronic
969261229 4:6035403-6035425 TTCATGACTCCTGATTGACGAGG - Intronic
969895884 4:10304111-10304133 TTCATCAGTTTTGTGTGATGTGG + Intergenic
970355742 4:15250392-15250414 GGCATCACTCATGAGTGAAGAGG + Intergenic
974747283 4:66091987-66092009 TTCATCACTCATGAGAGGCAAGG - Intergenic
975900311 4:79143667-79143689 ATTAGCACTCTTGAGTGACCAGG + Intergenic
979103209 4:116649671-116649693 TTCATCACTCGTGAGAGACAAGG + Intergenic
980552010 4:134350307-134350329 GTCATCTCTCTTGATTGAAGAGG + Intergenic
981462401 4:145028733-145028755 TTCACCACTCTTGAGCGGCAAGG + Intronic
984061440 4:174992805-174992827 TTCATCACTCGTGAGAGGCAAGG - Intergenic
986013117 5:3734725-3734747 TTCATGACCCCTCAGTGACGTGG + Intergenic
987015725 5:13816893-13816915 TTCCTCACTCCTGAGTGAGCAGG - Intronic
988325586 5:29762606-29762628 TTCATCATTGTTGAGTGCCATGG + Intergenic
992853512 5:80836234-80836256 TTGTTAACTCTTGAGTGATGTGG + Intronic
996165367 5:120215769-120215791 TTCACCACTCGTGAGAGGCGAGG - Intergenic
1002627891 5:180544763-180544785 TTCCCCTCTCTTGAGTGAAGAGG + Intronic
1006185097 6:32177117-32177139 TTCCTTACTCTTGAGTCACATGG + Intronic
1011068644 6:83358262-83358284 TTCATCACTCATGAGAGGCAAGG + Intronic
1011227778 6:85126881-85126903 TTCATGACTTTTGAGTGAAGAGG - Intergenic
1011737244 6:90323692-90323714 ATCAGAACTCTTGAGTGACTAGG + Intergenic
1012296205 6:97527767-97527789 CTCATAACTCACGAGTGACGGGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1013933189 6:115560354-115560376 TTCAGAGCTCTTGAGTGACTAGG - Intergenic
1015475343 6:133654258-133654280 TTCATCGCTCATGAGAGACAAGG + Intergenic
1020577176 7:9947706-9947728 TTCATCACTGCTGAGTAAAGTGG + Intergenic
1024161620 7:46682090-46682112 TTTCTCACTCACGAGTGACGGGG - Intronic
1027407202 7:77874126-77874148 TTCATCACTCATGAGAGGCAAGG - Intronic
1030151058 7:106405413-106405435 ATCAGCACTCTTGGGTGACAAGG + Intergenic
1032443314 7:131959058-131959080 TGCATCACTATTGGCTGACGGGG + Intergenic
1038018812 8:23536106-23536128 CCCCTCACTCTTGAGTGACTCGG + Intronic
1042409759 8:68450606-68450628 ATCAGCACTCTGGAGTGACTGGG + Intronic
1043483326 8:80674638-80674660 TGCATCCCTCTTGAATGGCGTGG - Intronic
1045221372 8:100203593-100203615 TTCATCACTCATGAGAGGCAAGG + Intronic
1048323956 8:133424527-133424549 TTCATCACTCACAAGTTACGTGG + Intergenic
1048442293 8:134469007-134469029 CACAGCACTCTTGAGTGATGAGG + Intergenic
1051402083 9:16693958-16693980 ATCTTCACTCTTGATTGCCGCGG - Intronic
1051647328 9:19281401-19281423 TTCCTCACTCTAGTGTGAAGGGG + Intronic
1051881730 9:21847534-21847556 TTCATCACTCGTGAGAGGCAAGG + Intronic
1058032805 9:100217695-100217717 GTGAGCAATCTTGAGTGACGAGG - Intronic
1058163951 9:101599533-101599555 TTCATCACTGTGGATTGATGTGG + Intronic
1059066523 9:111091453-111091475 TTCAGCACTCATGAGAGACAAGG + Intergenic
1060508679 9:124216735-124216757 TTCCTCACTTATGAGTGCCGTGG + Intergenic
1194849556 X:98854541-98854563 TTCATCACTCATGAGAGGCAAGG - Intergenic
1197074442 X:122337970-122337992 TTCATCACTCATGAGAGGCAAGG - Intergenic