ID: 909488000

View in Genome Browser
Species Human (GRCh38)
Location 1:76195756-76195778
Sequence CTGGAGGAATGTTGGGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909488000_909488010 16 Left 909488000 1:76195756-76195778 CCTACTCCCCAACATTCCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 376
Right 909488010 1:76195795-76195817 CATGAGCATGAGTTCTATAAAGG 0: 1
1: 0
2: 1
3: 14
4: 132
909488000_909488011 24 Left 909488000 1:76195756-76195778 CCTACTCCCCAACATTCCTCCAG 0: 1
1: 0
2: 2
3: 40
4: 376
Right 909488011 1:76195803-76195825 TGAGTTCTATAAAGGAAGTCAGG 0: 1
1: 1
2: 1
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909488000 Original CRISPR CTGGAGGAATGTTGGGGAGT AGG (reversed) Intronic
901010198 1:6196718-6196740 ATAGAGGAATATTGGGGAATGGG + Intronic
901407642 1:9060414-9060436 CTGGAGGCATGTGGGGGTGTGGG - Intronic
901569198 1:10145681-10145703 CTGGATGAGTGTTGGGGCGAGGG - Intronic
902562076 1:17283809-17283831 CTGGGGGATTGTTGGGTACTAGG + Exonic
902864452 1:19269146-19269168 CTGAAGGAATGCAGGGGAGTAGG + Intergenic
904375942 1:30082562-30082584 CTGGAGGGCTGATGGGGAGGGGG + Intergenic
904385145 1:30136267-30136289 CTGGAGGAATGACGGGTAGTGGG + Intergenic
904697795 1:32339981-32340003 CTGGAGCAAGGTTTGGGAGGTGG + Intergenic
904879310 1:33682937-33682959 CTGGGGAAAAGGTGGGGAGTGGG - Intronic
905223028 1:36462026-36462048 TGGGAGGATTGTCGGGGAGTGGG - Intronic
905294072 1:36943030-36943052 CAGGAGGGATGCTGGTGAGTGGG - Intronic
905650036 1:39650163-39650185 CTGAAGGAATGTTGGACAGGAGG + Intergenic
906390131 1:45407958-45407980 CAGGAGAGATGTTGGGAAGTGGG - Intronic
907101745 1:51844155-51844177 CTTGAGGTGTGTTGGGGCGTCGG - Intronic
907193797 1:52669954-52669976 ATGGAGGAATGTTGGTGGGATGG - Intergenic
907753172 1:57283331-57283353 CTAGAGGAATATGGGGTAGTTGG - Intronic
907834045 1:58092553-58092575 CTGGAAGTCTGCTGGGGAGTGGG - Intronic
909144640 1:71914592-71914614 CTAGAGAAATGTGGGGGTGTTGG + Intronic
909488000 1:76195756-76195778 CTGGAGGAATGTTGGGGAGTAGG - Intronic
909925297 1:81431202-81431224 TTGGAGGTAGGGTGGGGAGTTGG + Intronic
912107968 1:106304561-106304583 CTGGAAGAATTTGGAGGAGTAGG - Intergenic
912307217 1:108580694-108580716 CTTGAGGAGAGTTAGGGAGTAGG - Intronic
912812682 1:112805755-112805777 CTGGAGGTCTGGTGGGGAGGTGG + Intergenic
913405469 1:118486240-118486262 ATGGAGGAAGGATGGGGGGTTGG - Intergenic
913565719 1:120070059-120070081 CTAGAGGAATGCTCTGGAGTAGG + Intergenic
913632410 1:120723495-120723517 CTAGAGGAATGCTCTGGAGTAGG - Intergenic
914250640 1:145918912-145918934 CTGGAGGCGTGCTAGGGAGTAGG - Intergenic
914286311 1:146229433-146229455 CTAGAGGAATGCTCTGGAGTAGG + Intergenic
914547343 1:148680175-148680197 CTAGAGGAATGCTCTGGAGTAGG + Intergenic
914619172 1:149390185-149390207 CTAGAGGAATGCTCTGGAGTAGG - Intergenic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
915357716 1:155265947-155265969 ATGGAGGACTGTAGGGGAGAAGG + Exonic
915508414 1:156371965-156371987 GTGGGGGAAGGTTGGGGAGGCGG + Intronic
915573663 1:156760614-156760636 CTGGATGAGTGTTGGGGGATGGG + Intronic
916419857 1:164626809-164626831 CTGCAGGCATGATGGGGAGCAGG - Intronic
916666871 1:166975078-166975100 CTGGTGGAAAGTGGGGGAGGGGG - Intronic
917729537 1:177861072-177861094 CTGGGGGCCTGTTGGGGGGTTGG + Intergenic
917849329 1:179047035-179047057 CTGGAGAATTGAAGGGGAGTTGG + Intronic
920223191 1:204419460-204419482 CTGGAGGAATTACTGGGAGTGGG - Intergenic
921295263 1:213695392-213695414 CTGGAGGAGTGGTGGAGAGGTGG + Intergenic
922538908 1:226404298-226404320 CTGGTGGAACGTTTGAGAGTTGG - Intronic
922667160 1:227480382-227480404 CTGGGGGAGTTTTGGAGAGTGGG + Intergenic
923203796 1:231738716-231738738 ATGGAGGTTTGATGGGGAGTAGG - Intronic
924577008 1:245289978-245290000 CTGGAGGAAGGATGGAGGGTAGG - Intronic
1063324416 10:5083231-5083253 CTGGGGGACTGTTGTGGGGTGGG - Intronic
1063329797 10:5146185-5146207 CTGGGGGACTGTTGTGGGGTGGG + Intergenic
1063609024 10:7547570-7547592 CTGGAGGAATTTCGTGGACTTGG + Intergenic
1064344733 10:14521805-14521827 CTTGAAGAATGTTGGAGTGTTGG - Intronic
1064439463 10:15340637-15340659 CAGGAGGGAGGTTGTGGAGTGGG - Intronic
1065109653 10:22427219-22427241 CTGGAAGAATGGTGGGGTGGAGG + Intronic
1065473977 10:26114086-26114108 GTGGAGGGAGGTTGGGGAGGAGG - Intronic
1067188682 10:44051829-44051851 CTGGAGAAATGGGGGAGAGTGGG + Intergenic
1067217188 10:44312971-44312993 GTGGAGGAGTGCTGGGGAGCAGG + Intergenic
1068735391 10:60408415-60408437 CAGGAGGAAGGTTGGGGAGGGGG - Intronic
1068770167 10:60811850-60811872 CTGCGGGAAAGTTGGGGAGAAGG + Intergenic
1070580288 10:77713917-77713939 CTGGAGGGGTGCGGGGGAGTGGG - Intergenic
1071527132 10:86365392-86365414 CGGGAGGAATCTCGGGAAGTTGG - Intronic
1071857319 10:89638958-89638980 CTGGAAGAATGTGGGGAAGCAGG - Intronic
1072038935 10:91589767-91589789 CTGGGGGAGTGTGGGGGAGAAGG + Intergenic
1072980385 10:100093479-100093501 CGGGAGGGAGGTTGGGGTGTCGG + Intergenic
1073480110 10:103781037-103781059 CTGCAGGAGTGATGGGGAGGAGG - Intronic
1073842540 10:107514401-107514423 TTGAAGGAATGTGGGGGAGATGG - Intergenic
1074638290 10:115346258-115346280 CTGGAAGGAGGTGGGGGAGTGGG - Intronic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076450689 10:130555134-130555156 CTGGAGAAATGATGGTTAGTTGG - Intergenic
1076461331 10:130649464-130649486 ATGGAGGTATCATGGGGAGTAGG - Intergenic
1077673563 11:4179136-4179158 CTGGTGGTATGTTGGGGTGGAGG + Intergenic
1081418385 11:42842590-42842612 CTGGAGGAAGCTTGGGGCGAGGG - Intergenic
1081866804 11:46364764-46364786 CTGGACGCATGTTGGGCAGGAGG - Intronic
1081874921 11:46401958-46401980 CTGCAGGAATGTGGGGGACAGGG - Intronic
1084001071 11:66295678-66295700 ATGGTGGAATGGTGGGGAGGGGG - Exonic
1084129011 11:67119206-67119228 CTGGAGGAGGGGTGGGGAGGTGG + Intergenic
1085024812 11:73230244-73230266 ATGGAGGAACGGTGGGGAGGAGG - Intronic
1085236724 11:75021025-75021047 ATGGAGGACTGTTGTGGAGATGG - Intergenic
1087647397 11:100824181-100824203 CTGTAGGAATGTTTGTGAGAAGG + Intronic
1088458764 11:110060624-110060646 CTGTAGGAAGGTGAGGGAGTAGG + Intergenic
1089685064 11:120141529-120141551 CAGGAGGGATGTTGGGGTGGTGG - Intronic
1090037443 11:123261181-123261203 CTGGAGGCAGCTTGGAGAGTGGG - Intergenic
1090427107 11:126615714-126615736 CTGGAGGAATGTGGGGTAGGTGG - Intronic
1090548585 11:127792944-127792966 CTGGACGAATGGTGTGGAATGGG + Intergenic
1090622254 11:128570888-128570910 GTAGTGGAGTGTTGGGGAGTGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093441308 12:19199994-19200016 CTGGAGAAAGGTTGGTTAGTGGG + Intronic
1094344604 12:29453409-29453431 CTGGAGGAAAATTGAGGAGCTGG - Intronic
1095353177 12:41239315-41239337 GTGGAGGAATGTTGTGGGGAGGG + Intronic
1095439715 12:42228234-42228256 CTGGAGGGAGGTGGGGGTGTCGG + Intronic
1095749890 12:45697948-45697970 GTGGAGGAAAGTAGGGGAGGAGG + Intergenic
1096516919 12:52161625-52161647 CTGGAAGAATTTGGGGGAGCAGG - Intergenic
1096774962 12:53958024-53958046 CTGGGGGACTCTTGGGGAGAAGG - Exonic
1097100914 12:56588761-56588783 CTGTAGGAAGGTTGGGGAAGTGG + Intronic
1097160529 12:57043504-57043526 CTGGAGGAATCTCAGGGAGTTGG + Intronic
1097824118 12:64157111-64157133 CTGAAGGAGTGTTGAGGGGTGGG - Exonic
1098302533 12:69068902-69068924 CTGTATGAGTGTTGGGGGGTGGG - Intergenic
1100212882 12:92416467-92416489 CTTCAGGAATGTTGGGCCGTTGG - Intergenic
1101072223 12:101087720-101087742 CTGGAGGGAAGATGAGGAGTTGG - Intronic
1104058140 12:125245860-125245882 CTGGAGGACTGCTGGGGTGTGGG - Intronic
1104919532 12:132283342-132283364 CGGGAGGAATGATGGGGACGGGG + Intronic
1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG + Intronic
1108506627 13:51118339-51118361 CTGGAGGACTGTTGTGGAGGAGG - Intergenic
1113914079 13:113860734-113860756 CTGGAGGAATGTCGGGGGAGGGG + Intronic
1113927946 13:113951618-113951640 CTGGAGGAGGCTTGGGGAGCAGG - Intergenic
1114650682 14:24282717-24282739 CATGAGGAATGCTGGGAAGTAGG - Intergenic
1114987280 14:28246203-28246225 GTGGAGGAATGTTAGGCATTTGG + Intergenic
1117026997 14:51630978-51631000 CAGAAGGAATGTAGAGGAGTGGG + Intronic
1117830380 14:59744062-59744084 CTGAAGGAACTTTGGGGAGAAGG + Intronic
1119375830 14:74192006-74192028 CTGGAGTAATGTCGGGTACTAGG - Intronic
1119530023 14:75353456-75353478 CTGGAGGGACGTTGGGGTGGGGG + Intergenic
1119634252 14:76261329-76261351 TGGGAGGGATGTTGGGGAGAGGG - Intergenic
1120171184 14:81248341-81248363 CTGGAGTACAGTGGGGGAGTGGG - Intergenic
1121268866 14:92624368-92624390 GGGGAGGAATCTTGGAGAGTTGG + Intronic
1121465207 14:94111452-94111474 AGGGAGGGATGTTGGGGAGTTGG - Intronic
1122195520 14:100082172-100082194 CTGGAGGGATGCGGGGGAGGGGG - Intronic
1122574550 14:102733400-102733422 CAAGAGGAATGGTGGGGATTAGG - Intergenic
1123034624 14:105466873-105466895 CGGGAGGAATGTGGGGAACTGGG - Intronic
1123704665 15:22942528-22942550 CTGGAGCAGTGTGGGGCAGTGGG - Intronic
1124630493 15:31334077-31334099 CTGGAGAGATGTTGGGGGTTGGG + Intronic
1125033650 15:35098149-35098171 CTGAAAGAAGCTTGGGGAGTGGG + Intergenic
1125796104 15:42405051-42405073 CAACAGGAATGTTGGGGCGTGGG + Intronic
1126065706 15:44824793-44824815 CAGGAGGCCTGTTGGGGAGTTGG + Intergenic
1126094129 15:45075774-45075796 CAGGAGGCCTGTTGGGGAGTTGG - Exonic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1126972110 15:54127542-54127564 CTGGGGAGTTGTTGGGGAGTGGG + Intronic
1127719773 15:61688239-61688261 CTGGAGGAATCTTGGGCACTTGG + Intergenic
1128830028 15:70760245-70760267 CTAGAAGAAAGTTGGGGAGGGGG + Intronic
1129105457 15:73304331-73304353 CTGGGGATCTGTTGGGGAGTAGG - Exonic
1129932779 15:79426164-79426186 CTGAAGGAAACTGGGGGAGTTGG + Intronic
1130033172 15:80333980-80334002 CCAGAGGAATGCTGGGGAGGAGG + Intergenic
1130090386 15:80815980-80816002 CTGGAGGAATATTGGAAAGAGGG - Intronic
1130862300 15:87901747-87901769 AAGGAGGAAAGTTGGGGAGGGGG + Intronic
1132232240 15:100192869-100192891 CTGGGGGAGTGATGGGGAGGAGG - Intronic
1132414558 15:101611047-101611069 CTGGAGGAACAGTGGGGAGGAGG - Intergenic
1132803179 16:1763982-1764004 CTGGAGGCAGGTGGGGGCGTGGG - Intronic
1132982427 16:2745302-2745324 CTGGAGGGAAGCTGGGGAGGGGG + Intergenic
1133366723 16:5216147-5216169 CAGGAGGAATGTGGGAGGGTTGG + Intergenic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1135153895 16:20035637-20035659 ATGAAGGAATGTTTTGGAGTAGG + Intronic
1136509234 16:30725577-30725599 CTGGTGGAAGGTGGGGGAGTAGG - Intronic
1137597355 16:49733756-49733778 CTGAAGAAGTTTTGGGGAGTGGG + Intronic
1137620440 16:49873172-49873194 CTGGGGGAATCTGGGGGAGAAGG - Intergenic
1138588717 16:57987667-57987689 CTGGAGGACTGGTGGGGGGTTGG + Intronic
1138627250 16:58262087-58262109 CGGGGGGCATGTGGGGGAGTGGG - Intronic
1138643612 16:58406538-58406560 CTGGAGGGCTGCTGGGGAGAGGG - Intergenic
1139322667 16:66127932-66127954 CTGGAGGAAGGGTGGGGACCAGG + Intergenic
1139486702 16:67261213-67261235 CTGGAGGGATCTTGGGCTGTGGG - Intronic
1140782767 16:78311654-78311676 CTGTAGGAGAGATGGGGAGTAGG + Intronic
1141928453 16:87184568-87184590 GTGCAGGAAAGGTGGGGAGTGGG + Intronic
1142226597 16:88880711-88880733 CTGGAGGAAGGCTGGTGAGTGGG - Exonic
1142281079 16:89147822-89147844 TTGGGGGACTGTTGGGAAGTAGG - Intronic
1142419150 16:89959857-89959879 CTGGAGGAATGTTCTGGTGGGGG + Intronic
1142419180 16:89960031-89960053 CTGGAGGAATGTTCCGGTGGGGG + Intronic
1143095234 17:4475338-4475360 CTGGAGGGATGGTGGGGCCTGGG + Intronic
1143543123 17:7581286-7581308 ATGGGGGGATGCTGGGGAGTAGG - Intronic
1143839976 17:9724288-9724310 CCAGAGGAAAGTTGGGGGGTAGG + Intronic
1144244828 17:13352564-13352586 CTGCGGGAATGTTGGAGAATGGG - Intergenic
1144750390 17:17644472-17644494 CTGGGGTTATGTTGGGGAGTGGG - Intergenic
1145047641 17:19630740-19630762 CTGGAGCAAAGTTGTGGAGCAGG + Intergenic
1145908687 17:28530334-28530356 TTGCATGAATGTTGGAGAGTAGG - Intronic
1146470012 17:33116626-33116648 CTCCAGGAATGGTGGGGGGTGGG + Intronic
1148156514 17:45427861-45427883 CTGGAGGAAGGATGGGCAGAGGG + Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148979190 17:51556872-51556894 CAGGAGGAATTTGGGGGAGGAGG - Intergenic
1149224040 17:54447981-54448003 ATGGAGGCCTGTTGGGGGGTGGG - Intergenic
1149909173 17:60552088-60552110 CTGGAGGGAGGTGGGGGTGTCGG + Intergenic
1150388192 17:64776508-64776530 CTGGAGGAAGGATGGGCAGAGGG + Intergenic
1150442495 17:65202809-65202831 GGGGAGGAGTGTTGGGGAGGGGG - Intronic
1150791261 17:68201443-68201465 CTGGAGGAAGGATGGGCAGAGGG - Intergenic
1151215672 17:72575052-72575074 CTGGAGGAGTGTTGGGCCATGGG - Intergenic
1151319313 17:73343081-73343103 CTGGAAGCAAGGTGGGGAGTGGG + Intronic
1152618393 17:81348432-81348454 CTGGAGGAGTCCTGGGGAGATGG + Intergenic
1152910275 17:83000974-83000996 CAGGAGGAAACTTGGGGTGTTGG + Intronic
1153083364 18:1254861-1254883 AGGGAGGAAAGTTGGGGGGTGGG + Intergenic
1153181116 18:2434841-2434863 ATGGAGAAGTGTTGGGAAGTGGG + Intergenic
1153904551 18:9649817-9649839 AGGGAGGAAAGCTGGGGAGTGGG - Intergenic
1153997110 18:10452805-10452827 CTTCACGAATGTTGGGCAGTTGG - Intergenic
1154177515 18:12094626-12094648 GTGGAGGACTGGTGGGGGGTGGG + Intronic
1154485828 18:14870915-14870937 CTGGATGAATGTTTGGGCGGGGG - Intergenic
1157739782 18:50082165-50082187 CTGGAGGAGAGTTGGAGAGAGGG + Intronic
1160681621 19:414050-414072 CCAGAGGAGTGCTGGGGAGTAGG - Intergenic
1161512479 19:4679341-4679363 CGGGAGGAGAGTGGGGGAGTGGG - Intronic
1162567824 19:11453995-11454017 CTGGTGGAATGCGGGGGAGCAGG - Exonic
1163404131 19:17112138-17112160 CAAGAACAATGTTGGGGAGTGGG + Intronic
1164887597 19:31795686-31795708 CTGGAGGCAGGTTGGGGCATGGG - Intergenic
1165043017 19:33082191-33082213 CTGGTGGAATGTGGGGGTGAGGG + Intronic
1166459559 19:42974148-42974170 CTGGAGGGATGTTGGAGACTGGG + Intronic
1166476877 19:43134193-43134215 CTGGAGGAATGATGGAGACTGGG + Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925631603 2:5899418-5899440 CTGGGGGACTGTTGTGGGGTGGG + Intergenic
927177958 2:20423506-20423528 CCGGAAGAAGGTTGAGGAGTAGG + Intergenic
927242789 2:20933139-20933161 CTGTATGTATGTTGGGGAGAGGG + Intergenic
928892132 2:36216443-36216465 CTGGAGGGATATTGTGGAGGAGG - Intergenic
928994751 2:37276034-37276056 CTGGAGTAAGGGTGAGGAGTGGG - Intronic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929494256 2:42425484-42425506 ATAGAGGGATGATGGGGAGTGGG + Intergenic
929626822 2:43417845-43417867 GGGGGGGAATGTTGGGCAGTAGG - Intronic
930670698 2:54147304-54147326 CTTGAGGAATGGTGGTGACTGGG + Intronic
930751935 2:54942941-54942963 TAGGAGGAATGTAGGGGAGAAGG - Intronic
931464066 2:62471644-62471666 CTGAAGGAGTGCTGGGGAGGGGG + Intergenic
932596082 2:73094383-73094405 CTAGATGAATGTTGGGGCCTTGG - Intronic
933519619 2:83353316-83353338 CTGGGGGACTGTTGTGGGGTGGG + Intergenic
933848330 2:86345062-86345084 CTGGAGGCATTTTTGGAAGTTGG + Intergenic
934121887 2:88848063-88848085 CTGGAGCAATGTTCCTGAGTAGG - Intergenic
936843072 2:116797453-116797475 CAGTAGGGATGTGGGGGAGTGGG + Intergenic
937430712 2:121835792-121835814 CTGGTGGGGTGTTGGGGGGTGGG + Intergenic
939161947 2:138601369-138601391 CTGGATGAATGTGGGGGAGAGGG - Intergenic
939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG + Intergenic
939992611 2:148889466-148889488 ATTGATGGATGTTGGGGAGTGGG - Intronic
941296154 2:163740961-163740983 CTCTAGGAAGGTTGGGGTGTGGG - Intergenic
941811685 2:169761746-169761768 CTGAACAAAGGTTGGGGAGTGGG - Intronic
942008520 2:171734551-171734573 CTGGAGGGATGTTGGGGGCAGGG - Intronic
943097240 2:183444164-183444186 CTTGAAAAATGTTTGGGAGTTGG + Intergenic
945148335 2:206762208-206762230 GCAGAGGAATGTTGGGGAGAAGG - Intronic
946540939 2:220684019-220684041 TTTGAGGAATGGTGAGGAGTCGG + Intergenic
947911851 2:233806612-233806634 CATGACGTATGTTGGGGAGTAGG + Intronic
948924576 2:241086982-241087004 TTTGAGGAGTGTTGGGGATTCGG - Intronic
1169285159 20:4301636-4301658 GTGGGGAAATGTAGGGGAGTAGG - Intergenic
1171100561 20:22379739-22379761 CTGCAGAAATGTTGGGGTTTGGG - Intergenic
1171810148 20:29740933-29740955 TTGGAGGGGTGTTGGGGAGGAGG + Intergenic
1171865219 20:30484348-30484370 TCGGAGGAGTGTTGGGGAGGAGG + Intergenic
1172274584 20:33672763-33672785 CTTGAGGAAGGTTGAGGAGATGG + Intronic
1172430872 20:34890494-34890516 CTGGAGGACTGTCGGGGATTTGG + Intronic
1172696705 20:36828014-36828036 CTGGAGGAATGTTCTGGCCTTGG + Intronic
1174060927 20:47832646-47832668 CTGGAGGCTTGGTGGGGAGCCGG - Intergenic
1174070970 20:47898724-47898746 CTGGAGGCTTGGTGGGGAGCCGG + Intergenic
1174153088 20:48499934-48499956 CTGGAGGCTTGGTGGGGAGCCGG - Intergenic
1174318873 20:49725057-49725079 GTGGGGGCAGGTTGGGGAGTGGG - Intergenic
1174354655 20:49989856-49989878 CTGAAGGGAAGTTAGGGAGTTGG + Intergenic
1175332067 20:58172022-58172044 CTGAAGGATGGTTGGGGAGGTGG - Intergenic
1175934571 20:62509115-62509137 GTGGAGGAGTGTTGGGGTGGAGG - Intergenic
1179648417 21:42790550-42790572 CTGGAGGGATGTCTGTGAGTTGG - Intergenic
1181386933 22:22553194-22553216 CTTGGGGATTGTTTGGGAGTGGG - Intronic
1182434969 22:30324748-30324770 CCAGAGTAATGTTGGGAAGTGGG + Intronic
1183020929 22:35025132-35025154 CTGGGGACCTGTTGGGGAGTGGG - Intergenic
1183735773 22:39644034-39644056 CTGGAGGAGGGATGGGGAGGTGG + Intronic
1183741663 22:39672136-39672158 GTGGAGGAAGGTTGTGGAGCAGG + Intronic
1184411083 22:44326933-44326955 CTTGAGGAGCTTTGGGGAGTCGG - Intergenic
1184654678 22:45935151-45935173 CTGGAGGAAGGATGGCGTGTGGG - Intronic
1185060068 22:48602105-48602127 CTGGATGCAGGCTGGGGAGTCGG - Intronic
1185195079 22:49464351-49464373 CTGGGGGCAGGGTGGGGAGTGGG - Intronic
949764092 3:7506420-7506442 CTGGAAGAATTTGGAGGAGTAGG - Intronic
950292482 3:11796674-11796696 CTTGAGAAATTTTGGGGAGAAGG + Intronic
952307117 3:32156111-32156133 CTGGAGAGATGCTGGGGGGTCGG - Intronic
953370436 3:42383215-42383237 TGGGAGGAAGGTTGAGGAGTAGG - Intergenic
955094395 3:55782758-55782780 CTGGCTGAATGTGGGGGAGAGGG - Intronic
955429907 3:58831998-58832020 ATGGAGGCATGTTAGGGATTTGG - Intronic
955598695 3:60620885-60620907 CTGGGGGAGTGGTGGGGCGTAGG + Intronic
955838179 3:63081280-63081302 TTGGAGGAATGTGGGAGAATTGG + Intergenic
956061595 3:65353626-65353648 CTGAAAGAATGTTGGGGGGGAGG - Intronic
957703175 3:83745130-83745152 CAGGAGGGAGGTTGGGGAGAGGG - Intergenic
959665689 3:108918201-108918223 CTGGAGACATTTTGGTGAGTTGG - Intronic
961098481 3:124177662-124177684 TTGGAGGAATATTAGGGAGTTGG + Intronic
961134340 3:124496056-124496078 CTGGAGGAGTTTTGGGGAAGGGG + Intronic
961240119 3:125403481-125403503 CTGGAGGGAAGTTGGTTAGTAGG - Intergenic
961411913 3:126728344-126728366 CAGGAGGAATGGTGGTGGGTGGG + Intronic
961478657 3:127164974-127164996 CTGGAGAGATGCTGGGGAATTGG - Intergenic
961511517 3:127406644-127406666 GTGGGGGAATGTTGGGCAGAGGG + Intergenic
961820055 3:129571357-129571379 ATGGAGAAACGGTGGGGAGTGGG + Intronic
963728853 3:148951156-148951178 CTTGAGGACTGTTTGGGAGTGGG - Intergenic
963820912 3:149892480-149892502 CTGGAGACCTGTTGGGGAATTGG + Intronic
965664597 3:171079542-171079564 CTGGATCACTGTTGGGGACTTGG - Exonic
967185893 3:186944289-186944311 CTGGAGGAACGTGGGGTAATGGG + Intronic
968041881 3:195595847-195595869 CTGGGGGGGTGTTGGGGAGTGGG - Intergenic
968665255 4:1817870-1817892 CAGGAGGATTGCTTGGGAGTGGG - Intronic
968761426 4:2444354-2444376 CTTGAGGCAGGTTGGGGAGAGGG - Intronic
969111536 4:4847301-4847323 CTGGAGGAAGGGTCGGGATTTGG - Intergenic
971196511 4:24475476-24475498 CTGTAGGAAGGAGGGGGAGTTGG - Intergenic
973593647 4:52465445-52465467 CGGGAGGGAGGTGGGGGAGTCGG + Intergenic
973593695 4:52465543-52465565 CGGGAGGAAGGTGGGGGTGTCGG + Intergenic
975104004 4:70548226-70548248 CTTTAAGAATGTTGGGGAATTGG - Intergenic
975144244 4:70950114-70950136 ATTGAGTAATGTTGGGTAGTGGG + Intronic
979723534 4:123932699-123932721 CTGGGGGAAGGTTGGGGGGAGGG + Intergenic
979902625 4:126242119-126242141 CTGCAGGAATGTGGGGTTGTGGG + Intergenic
980120065 4:128718423-128718445 CTGGTGGCTTCTTGGGGAGTTGG + Intergenic
980253417 4:130347400-130347422 CTGGGGACATGCTGGGGAGTAGG + Intergenic
980720211 4:136685983-136686005 CTGCAGGAATTATGGGGAATGGG + Intergenic
980867720 4:138573037-138573059 CTGGGGGACTGTTGTGGGGTGGG - Intergenic
982445880 4:155490267-155490289 TTGGAGGAATGAAGAGGAGTTGG + Intergenic
982981066 4:162136138-162136160 CTGGGGGAATTTTGGGGTGTGGG - Intronic
983722137 4:170868680-170868702 CTGGAGGAATTTTAGGGAAGTGG - Intergenic
984665072 4:182418445-182418467 CTGCATGATTGTTGGGGGGTGGG + Intronic
985069174 4:186151215-186151237 CTTGAGGGATGGTGGTGAGTGGG - Intronic
985948329 5:3203750-3203772 CTGGAGGGATGTAGGGGAAGAGG - Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986624097 5:9707278-9707300 TTGGAGGTGTGCTGGGGAGTTGG - Intronic
986813749 5:11385647-11385669 CTGGGGCAAGGGTGGGGAGTGGG - Intronic
986964470 5:13253867-13253889 CAGAAGGAATTATGGGGAGTGGG - Intergenic
990012362 5:51014974-51014996 CTGGAGGTGTGTTCTGGAGTCGG - Intergenic
990602638 5:57376419-57376441 CTGAAGGCATGTTGGGGTTTTGG + Intergenic
991216258 5:64160022-64160044 GGGGAGGAATCTTGGAGAGTTGG - Intergenic
992224862 5:74610595-74610617 CAGGAGCAATTGTGGGGAGTTGG - Intergenic
993298700 5:86179293-86179315 ATGGGGAAATGATGGGGAGTGGG - Intergenic
993424632 5:87748037-87748059 CTGGAAGGAGGTGGGGGAGTTGG + Intergenic
994114768 5:96049774-96049796 CAGGATGGATATTGGGGAGTTGG + Intergenic
994883160 5:105524491-105524513 CTGGAGAGATGTTGGGGAGTCGG - Intergenic
994953201 5:106492750-106492772 TTGCAGGAATGTGGGGAAGTAGG + Intergenic
997460841 5:134051224-134051246 CTGGAGGGCTGTGGGAGAGTTGG - Intergenic
998544396 5:143014255-143014277 CTGGCGGAAAGTTGGGGTGGAGG - Intronic
1001005116 5:168043019-168043041 AGGGAGGAATGTTAGGGAGAGGG + Intronic
1001285259 5:170418447-170418469 CTGGAGAAATGATGGGAAGAGGG - Intronic
1001581728 5:172803135-172803157 CTGGAGCACTGTTGGGAAGAGGG + Intergenic
1002210122 5:177593762-177593784 CTGGAGGCATGCTGGTAAGTGGG + Exonic
1005223204 6:23612054-23612076 CTGGAAGCAGGCTGGGGAGTTGG - Intergenic
1006082671 6:31576519-31576541 CTGGGGAACTGTTGGGGAGAAGG - Exonic
1006492688 6:34398491-34398513 CGGGAGGGAGGTTGGGGGGTCGG + Intronic
1006681197 6:35797968-35797990 CTGAAGGAAGGTTGAGGGGTGGG - Intergenic
1006806228 6:36791494-36791516 CTGTAGGACTGTGGGGGAGCAGG - Intronic
1006833292 6:36981923-36981945 ATGTAAGAATGTTGGGGTGTGGG - Intronic
1006923890 6:37643748-37643770 CTGGAGGATGGGAGGGGAGTGGG - Intronic
1007071477 6:39041411-39041433 CTGGAGGAAAGGTGGGGAGCTGG - Intergenic
1007111240 6:39314442-39314464 GAGGAGGAGTGTTGGGGAATGGG + Exonic
1008878328 6:56353476-56353498 CTGTAGGAATGTCTGGGACTGGG - Intronic
1009295412 6:61940995-61941017 CTGGTGAAATGTTTGGGAGAGGG - Intronic
1010144718 6:72654219-72654241 CTGGAAGAGTGTTGGGGGTTTGG + Intronic
1011405004 6:87009691-87009713 CGGGAGGGAGGTTGGGGGGTCGG - Intronic
1011845841 6:91562019-91562041 CTGGAGGTATGTCTGGGTGTAGG - Intergenic
1012638788 6:101582224-101582246 CTGTTGGCCTGTTGGGGAGTAGG - Intronic
1012926865 6:105276142-105276164 CTAAAGGTATTTTGGGGAGTAGG - Intergenic
1013232554 6:108170472-108170494 CTGGAGGAGTGTCAGGGAGAGGG - Intronic
1013418243 6:109943749-109943771 CTGGAGCATTGTTGGGGAGTGGG - Intergenic
1014574713 6:123056032-123056054 CTGGAGGTAGACTGGGGAGTGGG + Intronic
1015138376 6:129900531-129900553 GTGTAGGAGTTTTGGGGAGTGGG - Intergenic
1015245247 6:131067278-131067300 CTGCAGGCATGTAGTGGAGTGGG - Intergenic
1015546324 6:134365337-134365359 CTGGGGGATTGATGGGGAGATGG + Intergenic
1015715694 6:136189730-136189752 CTGGAGGGATGGTGGGGTGACGG - Intronic
1015908479 6:138142816-138142838 TTGGAGAAATGTTGGGTACTAGG + Intergenic
1016291012 6:142528002-142528024 CTGGGTCAATGTTGTGGAGTGGG + Intergenic
1016363704 6:143293775-143293797 CTGTAGGGAAGCTGGGGAGTGGG - Intronic
1018339060 6:162830344-162830366 CTGGAGCCATGTGGGTGAGTGGG - Intronic
1018972324 6:168538071-168538093 CTGCTGGGATGTGGGGGAGTGGG + Intronic
1018972349 6:168538159-168538181 CTGCTGGAATCTGGGGGAGTGGG + Intronic
1018972390 6:168538278-168538300 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972401 6:168538308-168538330 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972429 6:168538396-168538418 CTGCTGGCATGTAGGGGAGTGGG + Intronic
1018972438 6:168538426-168538448 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972454 6:168538486-168538508 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972463 6:168538516-168538538 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972472 6:168538546-168538568 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972491 6:168538606-168538628 CTGCTGGAATCTGGGGGAGTGGG + Intronic
1018972500 6:168538636-168538658 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972525 6:168538728-168538750 CTACTGGAATGTGGGGGAGTGGG + Intronic
1018972543 6:168538787-168538809 CTGCTGGAATCTGGGGGAGTGGG + Intronic
1018972554 6:168538817-168538839 CTGCTGGAATCTGGGGGAGTGGG + Intronic
1018988824 6:168658086-168658108 CTGGGGGACTGATGGGGAGATGG + Intronic
1019539893 7:1546797-1546819 CTGGAGGGAGGATGGGAAGTGGG + Exonic
1021993940 7:26161768-26161790 GTGGAGGTAGGTTGGGGAATGGG + Intronic
1022754667 7:33273912-33273934 CTACAGGAATGTGGGGAAGTTGG - Exonic
1023465826 7:40453322-40453344 CTGGAACCATGCTGGGGAGTGGG + Intronic
1023789055 7:43737544-43737566 CTGCAGGAATGTTGGGGGTTGGG - Intergenic
1023839055 7:44085720-44085742 CTGGAGGATGGTTGGGGAGGGGG + Intergenic
1023932388 7:44713712-44713734 CTGGATGAAGGGTGGGGAGGGGG - Intergenic
1026487603 7:70834940-70834962 ATGGTGGAAGGTGGGGGAGTGGG + Intergenic
1027305519 7:76892321-76892343 CTGTAGGAAGGTGGGGGAGCTGG + Intergenic
1027530556 7:79325979-79326001 TTGGAGGAAGTTTGGGGAGATGG - Intronic
1028514954 7:91667782-91667804 CTGGAGGTCTGTTGGGGTGGTGG - Intergenic
1029421842 7:100476025-100476047 GTGGGGGAAGGCTGGGGAGTAGG + Intronic
1029483212 7:100825010-100825032 CTGGAGGAAGGGGGGGGATTAGG + Intronic
1029935186 7:104417024-104417046 GTGAAAGAATGTTGGGAAGTGGG - Intronic
1030983900 7:116218025-116218047 CTGTTAGAATGGTGGGGAGTCGG + Intronic
1032650434 7:133872115-133872137 CTGGAGGAAAGGTGGGGATCAGG + Intronic
1034200204 7:149279403-149279425 CTGCAGGAGTGTTGGGGACATGG + Intronic
1035637292 8:1156344-1156366 CCGGAGGAGAGTTGGGGAGGCGG + Intergenic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1037496540 8:19446388-19446410 CTGGAGGGATCTTAGGAAGTTGG - Intronic
1037635979 8:20701319-20701341 CTGGAGGAATTTGGGGGAAAGGG - Intergenic
1037760816 8:21740357-21740379 CTAGAGAAATGTTGGCCAGTTGG - Intronic
1037767717 8:21782290-21782312 CTGGAGGAAGGGGGGTGAGTGGG - Intronic
1037804647 8:22052379-22052401 CTAGAGGGATGGTGGGGTGTTGG - Intronic
1037817973 8:22121648-22121670 TTGCAGGAAGGTTGTGGAGTTGG + Exonic
1038203377 8:25438595-25438617 CTTGAGGAATGGTAGGCAGTTGG - Intronic
1038528298 8:28295993-28296015 CTTGAGGAATGGAGGGGAGTAGG - Intergenic
1039458968 8:37727552-37727574 TTGGAGGAATGAAGGGGGGTGGG - Intergenic
1039964976 8:42277632-42277654 CTGGAGGAATGTGGAGGAGGGGG - Intronic
1041487861 8:58398720-58398742 CTGGGGGAAATTTGGGGGGTTGG - Intergenic
1042350897 8:67776504-67776526 CTTGAAGAATGTTGGGGAGGTGG + Intergenic
1042454492 8:68984801-68984823 GTGGAGGAATCCTGGGCAGTAGG - Intergenic
1042975994 8:74470031-74470053 CTGGAGGTTTATTTGGGAGTTGG + Intronic
1043147629 8:76677530-76677552 CTGGAGGGACATTGGGGAGAGGG + Intergenic
1047299948 8:123605407-123605429 CTGGAACAGTTTTGGGGAGTGGG - Intergenic
1048767496 8:137860834-137860856 CTGGAGGAAGGGAGGAGAGTTGG + Intergenic
1051201641 9:14633355-14633377 CAGTGGGAATGTTGGGCAGTAGG - Intronic
1051432206 9:16991238-16991260 TGGGAGGAATGGTGGGGAGCAGG - Intergenic
1051517867 9:17951025-17951047 TTAGAGGAATTTTGGGGAGGGGG - Intergenic
1051615757 9:19004703-19004725 CTGGGGGCCTGTTGTGGAGTAGG + Intronic
1052395004 9:27928207-27928229 GGGGAGGAATGTGGGGTAGTGGG + Intergenic
1053172246 9:35896534-35896556 CGGGAGGATTGTTTGGGAGGAGG + Intergenic
1053226582 9:36363549-36363571 CTTGATGAATGTAGGTGAGTTGG - Intronic
1054846183 9:69800989-69801011 TTGGAGGAAGGTTGTGGACTTGG + Intergenic
1056387815 9:86113511-86113533 ATGGAGAAATGGTGTGGAGTTGG + Intergenic
1056728940 9:89147390-89147412 CAGGAGGATGGGTGGGGAGTTGG - Intronic
1056770853 9:89477021-89477043 CTGGAGGCATGGAGGAGAGTGGG + Intronic
1057501953 9:95603136-95603158 CTGGAGGAAGCTGGGGGAGTTGG - Intergenic
1057817165 9:98304225-98304247 CTGGAGGGATGGTGGGGGGAAGG + Intronic
1057834700 9:98434883-98434905 CTAGGGGAATTGTGGGGAGTGGG + Intronic
1058546116 9:106061750-106061772 ATGGAGCAGTGTTGGGAAGTGGG + Intergenic
1060680454 9:125558425-125558447 CTGGGGGTAAGCTGGGGAGTGGG - Intronic
1061416712 9:130451111-130451133 CAGGAGGCATGTGGGGGAGGGGG + Intronic
1061613904 9:131766668-131766690 CTGCAGGGATGTGGGGGAGAGGG + Intergenic
1061876384 9:133546227-133546249 CTGCAGGGGTGGTGGGGAGTGGG + Intronic
1062107519 9:134764014-134764036 CTGGGGGCATTGTGGGGAGTCGG + Intronic
1062520114 9:136954270-136954292 CTGCAGGCATGCTGGGCAGTAGG + Intronic
1062612220 9:137380393-137380415 CTGGAGGGGGGTTGGGGAGGAGG - Intronic
1203360435 Un_KI270442v1:216672-216694 TTGGAGGGGTGTTGGGGAGGAGG + Intergenic
1186186932 X:7029801-7029823 CTGGAGGGATGATGGAGATTGGG + Intergenic
1186755974 X:12671992-12672014 AAGGAGGAATTTTGTGGAGTTGG - Intronic
1186886680 X:13921311-13921333 CTGTAGGAAGGTTTGGGATTTGG - Intronic
1186917074 X:14234385-14234407 CTGGAGGAATGTGAGGAAGAGGG - Intergenic
1186984105 X:14992844-14992866 GTGATGTAATGTTGGGGAGTGGG - Intergenic
1190220686 X:48510502-48510524 CTATAGGAATCTTGGGGACTTGG - Intronic
1192099488 X:68248955-68248977 GTGGAGGGATGATGGGGAGGTGG + Intronic
1193102862 X:77635803-77635825 CTGGAGGTAAATTGGTGAGTGGG - Intronic
1194922471 X:99783086-99783108 TTGGAGAAATGTTGGGGAGAGGG + Intergenic
1195683832 X:107568381-107568403 CTGGAGGACTGTTGTGGGGTGGG - Intronic
1198194482 X:134346135-134346157 CTGTTGGAAGGTAGGGGAGTAGG - Intergenic
1198545670 X:137690203-137690225 CTGCAGGAATTTTGGGGATCAGG + Intergenic
1199641807 X:149869246-149869268 CTGGAGGAGAGTTGGGGTTTAGG + Intergenic
1200138726 X:153886853-153886875 CTGGAGGAAAATCTGGGAGTTGG - Intronic
1200562170 Y:4718525-4718547 TTGGGGGAATGTAGGGGAGGGGG - Intergenic
1202298485 Y:23385081-23385103 CTGGAGGAATATTGGTGAAATGG - Intergenic
1202572323 Y:26285518-26285540 CTGGAGGAATATTGGTGAAATGG + Intergenic