ID: 909491249

View in Genome Browser
Species Human (GRCh38)
Location 1:76229054-76229076
Sequence CTGATTATATGAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909491247_909491249 6 Left 909491247 1:76229025-76229047 CCGCTCTGGTTTCATTTAGGGCT 0: 1
1: 0
2: 1
3: 28
4: 167
Right 909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG No data
909491246_909491249 7 Left 909491246 1:76229024-76229046 CCCGCTCTGGTTTCATTTAGGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG No data
909491242_909491249 26 Left 909491242 1:76229005-76229027 CCAGGCTAATGCTCATGGGCCCG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909491249 Original CRISPR CTGATTATATGAATGGACAA TGG Intronic
No off target data available for this crispr