ID: 909494936

View in Genome Browser
Species Human (GRCh38)
Location 1:76268021-76268043
Sequence TGGAGATCTGTGAGTCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909494936_909494940 15 Left 909494936 1:76268021-76268043 CCTATAGGACTCACAGATCTCCA 0: 1
1: 0
2: 0
3: 20
4: 148
Right 909494940 1:76268059-76268081 AAATTGTAGTCCTATCCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909494936 Original CRISPR TGGAGATCTGTGAGTCCTAT AGG (reversed) Intronic
902271839 1:15310365-15310387 TGGATACTTGTGAGCCCTATGGG + Intronic
902618768 1:17638474-17638496 TGGGGTGCTGTGATTCCTATAGG + Intronic
903741896 1:25563145-25563167 TGAAGAGCTGTGAGTCCTGACGG + Exonic
903884535 1:26533321-26533343 TCGTGATCTGTGAGGCCTCTTGG + Intronic
908014483 1:59816223-59816245 TGGAAATGTGTGAAGCCTATTGG + Intronic
909494936 1:76268021-76268043 TGGAGATCTGTGAGTCCTATAGG - Intronic
913930287 1:124951963-124951985 TGGAGCACTTTGAGGCCTATGGG - Intergenic
913931694 1:124974872-124974894 TGGAGCTCTTTGAGGCCTATGGG - Intergenic
916881755 1:169025589-169025611 TAAAGAGATGTGAGTCCTATGGG - Intergenic
924438368 1:244066006-244066028 TGGTGTTCTGTGATTCATATAGG + Intergenic
1063064283 10:2592644-2592666 TTGAGATAAGTGAGTCCTGTGGG - Intergenic
1065825176 10:29564151-29564173 TTGAGTTCAGTGAGTCCTGTGGG - Intronic
1065952230 10:30662759-30662781 TTGAGTTCAGTGAGTCCTGTGGG + Intergenic
1066786330 10:39008033-39008055 GGGAGACCTTTGAATCCTATAGG - Intergenic
1066787110 10:39016953-39016975 TGGAGCCCTTTGTGTCCTATGGG - Intergenic
1066790143 10:39053298-39053320 TGGAGCCCATTGAGTCCTATGGG + Intergenic
1066796188 10:39124034-39124056 TGGAGTTCCTTGAGGCCTATGGG + Intergenic
1066797586 10:39140114-39140136 TGGAACCCTTTGAGTCCTATGGG + Intergenic
1066807436 10:39274191-39274213 TGGAGCTCACTGAGGCCTATGGG - Intergenic
1066816690 10:39427267-39427289 TGGAAAGCTTTGAGGCCTATGGG - Intergenic
1067061614 10:43080744-43080766 TTGATGTCTGGGAGTCCTATGGG + Intronic
1067195818 10:44117118-44117140 TGGAGATCTGAGAGACCCCTGGG + Intergenic
1072255749 10:93618781-93618803 TTGAGCTCTGTGAGTTCTATTGG + Intronic
1075028833 10:119006953-119006975 TGCAAATCTGTGAGTCTTTTTGG - Intergenic
1076127263 10:127984819-127984841 TGTGGAACTGTGAGTCCGATAGG + Intronic
1081297612 11:41411012-41411034 TGGTGATCTCTGCCTCCTATAGG - Intronic
1082154897 11:48796822-48796844 TGGAGCTCTTTGAGGCCTGTAGG - Intergenic
1082265789 11:50116647-50116669 GGGAGCCCTTTGAGTCCTATGGG - Intergenic
1082290299 11:50361923-50361945 GGGAGCCCTTTGAGTCCTATGGG + Intergenic
1082314540 11:50700920-50700942 TGGAGTGCTATGAGGCCTATGGG + Intergenic
1091697268 12:2636274-2636296 TGCAGCTCTGGGGGTCCTATGGG + Intronic
1098367693 12:69722430-69722452 TGGAGATCTCTGGGTCCTTGAGG - Intergenic
1105075058 13:16005562-16005584 TGGAGGTCTTTGTGGCCTATAGG + Intergenic
1105094947 13:16353940-16353962 TGGAGCGCTCTGAGGCCTATGGG + Intergenic
1105108616 13:16577191-16577213 TGGAGCGCTCTGAGGCCTATAGG + Intergenic
1105119516 13:16755598-16755620 TGGAGCGCTCTGAGTCCTACGGG + Intergenic
1105141692 13:17117820-17117842 TGGAGCGCTCTGAGTCCTACGGG + Intergenic
1105147637 13:17214529-17214551 TGGAGCGCTCTGAGTCCTACGGG + Intergenic
1105675823 13:22670887-22670909 TGCAGATCTGTGGCTCCTGTGGG - Intergenic
1106292420 13:28376805-28376827 TGGAGAGCTGCCAGTCCTTTAGG + Intronic
1111026524 13:82534953-82534975 TGTATATCTGTCAGTCCTAATGG - Intergenic
1111124068 13:83890409-83890431 TCCAGATATGTGAGTCCAATTGG - Intergenic
1111558507 13:89912324-89912346 GGGAGATATATGAGTCTTATTGG + Intergenic
1114000811 14:18242167-18242189 TGGAGAGCTTTGAGGCCTATGGG - Intergenic
1115266960 14:31510458-31510480 TGGAGATCTGTTGATTCTATGGG + Intronic
1117303283 14:54449145-54449167 GAGAGATCTGTGAGTCCTGCAGG - Intergenic
1119779464 14:77268683-77268705 TGGAGAACTGAGGGTCCTACTGG - Intronic
1129233043 15:74207282-74207304 GGGAGATCTGGGAGTCCTTGAGG - Intronic
1129494224 15:75962110-75962132 TGTAGATCTGTGAGCATTATAGG - Intronic
1130053697 15:80504864-80504886 TGGGGAGCTGTGAGTCCTTCCGG + Intronic
1132093719 15:98966506-98966528 TGGAGATCTGTCTCTGCTATGGG - Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1136744367 16:32571490-32571512 TGGAGCTCATTGAGGCCTATGGG + Intergenic
1137079795 16:36033477-36033499 TGGAGCTCTTTGAGACCTAATGG + Intergenic
1137949842 16:52773341-52773363 TGGAGTTCCCTGAGGCCTATGGG + Intergenic
1203025231 16_KI270728v1_random:503742-503764 TGGAGCTCATTGAGGCCTATGGG - Intergenic
1203046490 16_KI270728v1_random:830689-830711 TGGAGCTCATTGAGGCCTATGGG + Intergenic
1142489693 17:270202-270224 TGGAGGTCTGTGAGTGCATTCGG - Intronic
1142537362 17:627952-627974 TGTTGAGCTGTGAGTCCTAGGGG - Intronic
1145538291 17:24516892-24516914 TGGAGCGCTTTGAGGCCTATGGG + Intergenic
1148525437 17:48328467-48328489 AGGAGCTCTGTGATTTCTATAGG + Intronic
1150728974 17:67675305-67675327 TGGAGGTGTGTGAGCACTATAGG + Intronic
1153362312 18:4211176-4211198 TGGAAATCTGTTAGTTCTGTAGG - Intronic
1155689474 18:28600997-28601019 TTGACATCTGGGAGGCCTATGGG - Intergenic
1159644036 18:70896608-70896630 GGGAGATCTGTGGGATCTATGGG - Intergenic
1161596722 19:5154443-5154465 GGGTGATCTGCGAATCCTATTGG - Intergenic
1162983739 19:14256057-14256079 TGGAGATCTGTTTGTCATATTGG + Intergenic
1163836358 19:19576941-19576963 TGGAGAACAGTAAGTCCTGTGGG - Intronic
1164334887 19:24305810-24305832 TGGAACTCTTTGAGGCCTATGGG + Intergenic
1164600723 19:29561653-29561675 AGGAGATCTGTGAGGCCCATGGG + Intronic
1166858410 19:45795020-45795042 GGGAGCTCTGTCAGTCCTCTGGG + Intergenic
927074836 2:19567269-19567291 AGGAAATCTGTGATACCTATTGG - Intergenic
927779232 2:25926100-25926122 TGGAGATCTGTTTGCCCAATAGG - Intergenic
928387757 2:30884463-30884485 TGCAGAGCTGTGGGTCCTTTGGG + Intergenic
932145242 2:69310274-69310296 AGGAGGTCTCTGAGTCCTCTGGG + Intergenic
933147340 2:78870497-78870519 TGGAGCTCTCTGAGTCCTTAAGG - Intergenic
937396747 2:121543572-121543594 GGAAGAGCTGTGAGTCCTGTTGG - Intronic
938533190 2:132212603-132212625 TGGAGTGCTTTGAGGCCTATGGG + Intronic
1171578094 20:26359935-26359957 TGGAGAACTTTGAGGCCTATGGG + Intergenic
1171736769 20:28795150-28795172 TGGAGCGCTTTGAGGCCTATGGG - Intergenic
1171761638 20:29205679-29205701 TGGAGTGCTTTGAGTCCTATGGG + Intergenic
1171825085 20:29891053-29891075 TGGAGAGCTTTGAGGCCTATGGG + Intergenic
1171825275 20:29894793-29894815 TGGAGAGCTTTGAGGCCTATGGG + Intergenic
1171834840 20:30127910-30127932 TGGAGCGCTTTGAGGCCTATGGG + Intergenic
1172894778 20:38292732-38292754 GGTACATCTGTGAGTCCCATGGG + Intronic
1173105753 20:40132486-40132508 TGGAGAACTGTGAGTGCAGTTGG - Intergenic
1176321068 21:5325938-5325960 TGGAGAGCTTTGAGGCCTATTGG - Intergenic
1176478451 21:7255959-7255981 TGGAGAGCTTTGAGGCCTATTGG - Intergenic
1176481989 21:7306705-7306727 TGGAGGTCTTTGTGGCCTATAGG + Intergenic
1180070981 21:45435689-45435711 TGGGGAGCTGGGAGTCCTATAGG + Intronic
1180425322 22:15172965-15172987 TGGAGAGCTTTGAGGCCTATGGG - Intergenic
1180510453 22:16081465-16081487 TGGAGTGCTTTGAGGCCTATGGG - Intergenic
950168721 3:10821174-10821196 TGGAGGCCTGTGAGTCCTCTAGG + Intronic
950978464 3:17275916-17275938 TGGAGATCTATGATTCTGATTGG + Intronic
951643038 3:24857248-24857270 GGGAGAACTGAGAGTCCTAACGG + Intergenic
953244763 3:41180794-41180816 AGGAGATCTGTGTGTCCATTTGG + Intergenic
958205991 3:90393429-90393451 TGGAGTGCTTTGAGGCCTATTGG - Intergenic
958207126 3:90416430-90416452 TGGAGCTCATTGAGGCCTATGGG - Intergenic
958210080 3:90462893-90462915 TGGAGCTCCTTGAGGCCTATGGG - Intergenic
961622972 3:128239274-128239296 TGGGTATATGTGAGTCCTAAAGG + Intronic
962633732 3:137307535-137307557 TAGAAATATGTGAGTTCTATAGG - Intergenic
964827735 3:160848865-160848887 TGGAAATCTGGCAGTCCTCTAGG + Intronic
980703395 4:136460214-136460236 TGGACATCTGAGAGTCATGTAGG - Intergenic
986174508 5:5340596-5340618 GGGTGATCTGTGAGCCCTCTGGG - Intergenic
986453274 5:7888586-7888608 TGGAAACCTGTGACTCCTTTGGG + Intronic
987753316 5:22068676-22068698 TGAAGATATTTGTGTCCTATGGG + Intronic
989944470 5:50203342-50203364 TGGAGTGCTTTGAGGCCTATGGG - Intergenic
989945287 5:50219030-50219052 TGGAGCGCTTTGAGGCCTATGGG - Intergenic
990981050 5:61602733-61602755 TGGAGAGACTTGAGTCCTATTGG + Intergenic
994600659 5:101900059-101900081 TTCAAATCTTTGAGTCCTATTGG + Intergenic
995011160 5:107258445-107258467 TGGAAGTCTGAGAATCCTATTGG - Intergenic
997478133 5:134160495-134160517 TGGACTTCTTTGAGTTCTATTGG + Intronic
997641004 5:135448835-135448857 TGGGGATCAGGGAATCCTATTGG + Exonic
998228597 5:140345326-140345348 TGGATATCTGTGAATGCTACCGG - Intronic
999902168 5:156096235-156096257 GGGAGATCTGTGCATCCTAGTGG - Intronic
1001397650 5:171428609-171428631 TGGAGCTCTGTGAGTCCACCAGG - Intronic
1003616662 6:7660662-7660684 TGGAGAACGGTGTGTCCTCTGGG + Intergenic
1009730977 6:67606115-67606137 TAGAGAAATGGGAGTCCTATAGG - Intergenic
1011774226 6:90710095-90710117 TGGACATCTGGTAGCCCTATAGG - Intergenic
1012142730 6:95643526-95643548 TGGAGTTTTGTGGGTCCTTTTGG - Intergenic
1013580548 6:111529958-111529980 TGGGGATCTGAGAATTCTATAGG - Intergenic
1015479354 6:133690834-133690856 CGCAGATCTGAGAGTCCTAAAGG - Intergenic
1016142114 6:140625901-140625923 TGGAGATAATTGAGTCCTAAGGG - Intergenic
1019766260 7:2853235-2853257 TGGAGCCCTGTGAGTCATGTAGG + Intergenic
1021096133 7:16538332-16538354 TGAACATCTGTTAGTACTATAGG - Intronic
1022170669 7:27826293-27826315 TGTTTATCTGTGAGTCCCATAGG - Intronic
1023299076 7:38749546-38749568 TAGAGATTGTTGAGTCCTATTGG - Intronic
1024468008 7:49734266-49734288 TGGAGAGCTTTGATTGCTATAGG - Intergenic
1025031172 7:55558106-55558128 TGCAAATCAGTGAGTCCTAGAGG + Intronic
1025311816 7:57955306-57955328 TGGAGAGCTTTTAGGCCTATTGG - Intergenic
1025314162 7:57997039-57997061 TGGAGTGCTTTGAGGCCTATGGG + Intergenic
1025473385 7:60888690-60888712 TGGAGCACTTTGAGTCCTATAGG - Intergenic
1025513620 7:61601176-61601198 TGGAGCACTTTGAGTCCTATAGG + Intergenic
1025534126 7:61927104-61927126 TGGAGATCATTGAGGCCTATGGG + Intergenic
1025537966 7:62030015-62030037 TGGAGCACTTTGAGTCCTATAGG + Intergenic
1025548998 7:62218372-62218394 TGGAGCTCTTTGAGGCCAATGGG - Intergenic
1025570408 7:62555506-62555528 TGGAGCGCTGTGAGGCCTATAGG - Intergenic
1025578301 7:62676605-62676627 TGGAGCTCAGTGAGGCCAATGGG + Intergenic
1025597200 7:62945217-62945239 TGGAGATCATTGAGGCCAATGGG + Intergenic
1027531408 7:79338590-79338612 GGGGGTTCTGTGAGTCCCATAGG + Intronic
1027954906 7:84865298-84865320 TGAAGCTCTGTGAGTTCAATTGG + Intergenic
1031479477 7:122260843-122260865 TGGAGATCTGCGTGTTCTGTTGG - Intergenic
1031917317 7:127575558-127575580 TGGTGGTCAGTGAGTCCTCTGGG - Intergenic
1033127749 7:138720065-138720087 CGGAGTTCTGTGAGTCATTTTGG + Intronic
1035113352 7:156503443-156503465 TGGGATTCTGTGAGTCCTAGAGG + Intergenic
1040130968 8:43796104-43796126 TGGAGACCATTGAGGCCTATGGG + Intergenic
1040136419 8:43859574-43859596 GGGAGAGCTTTGAGGCCTATGGG + Intergenic
1040138070 8:43878643-43878665 TGGAGCCCAGTGAGGCCTATGGG - Intergenic
1040138338 8:43881571-43881593 GGGAGCTCTTTGAGGCCTATGGG - Intergenic
1041719467 8:60963179-60963201 TGGAGATCAGTGAGGAATATAGG + Intergenic
1046038100 8:108868296-108868318 TGGAGTTCTGAGAGTCCAAGGGG + Intergenic
1048600989 8:135918630-135918652 TGGAGATCTGTGAGAGCCAGTGG + Intergenic
1050052778 9:1620579-1620601 TGGAGTTATGTGAGTACTGTGGG + Intergenic
1053936243 9:43156185-43156207 TGGAGTGCTTTGAGGCCTATGGG + Intergenic
1054421660 9:64939446-64939468 TGGAGTGCTTTGAGGCCTATGGG + Intergenic
1056002512 9:82231553-82231575 TGGAGATGTGTGTGCCATATGGG - Intergenic
1203356986 Un_KI270442v1:162007-162029 TGGAGAGCTTTGAGGCCTATGGG - Intergenic
1203398761 Un_KI270519v1:57793-57815 TGGAGCACTTTGAGGCCTATGGG + Intergenic
1187758165 X:22548454-22548476 TGAAGAACTGTGACTCCTTTTGG + Intergenic
1191573446 X:62663152-62663174 TGGAGCTCTTTGAGGCCTTTGGG + Intergenic
1192155985 X:68746994-68747016 TGGAGATCTGAGAGCCCGAGAGG + Intergenic
1192619515 X:72663361-72663383 TGGTGTTCTGCAAGTCCTATAGG - Intronic
1194467353 X:94250069-94250091 TGGAGATTTTGGGGTCCTATGGG - Intergenic
1196821164 X:119702076-119702098 TGGAGAACTGTGAGGCCACTGGG - Intergenic
1200523427 Y:4241746-4241768 TGGTGTTCTGTAAGTCCCATAGG + Intergenic
1201776927 Y:17675972-17675994 TGGAGTCCTTTGAGGCCTATGGG - Intergenic
1201779630 Y:17705177-17705199 TGGAGCTCATTGAGGCCTATGGG - Intergenic
1201821925 Y:18200815-18200837 TGGAGCTCATTGAGGCCTATGGG + Intergenic
1201824630 Y:18230020-18230042 TGGAGTCCTTTGAGGCCTATGGG + Intergenic