ID: 909500179

View in Genome Browser
Species Human (GRCh38)
Location 1:76326096-76326118
Sequence GTTGCCATCCAGGCTGAGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909500179 Original CRISPR GTTGCCATCCAGGCTGAGAT CGG Intronic
900353469 1:2248266-2248288 GCTGCCAGCCAGGCTGAGTCCGG - Intronic
901428834 1:9199977-9199999 TTTGTCATCCAGGCTGGGAAGGG + Intergenic
901879649 1:12186201-12186223 GCTGCCTGCCAGGCTGAGGTGGG + Intronic
902099541 1:13974596-13974618 GTGACCATGGAGGCTGAGATGGG + Intergenic
902617424 1:17631354-17631376 CTTGACATCCAGCCTGAGGTTGG + Intronic
904621194 1:31776399-31776421 GCTGCCATCAGGGCTGAGACAGG - Intergenic
904797245 1:33065845-33065867 TCTGCCCACCAGGCTGAGATGGG - Intronic
904971931 1:34426145-34426167 GTTCTCACCCAGGCTGGGATAGG - Intergenic
906126126 1:43428028-43428050 GGTTCCATCCAGGCTGAGGATGG - Exonic
906730797 1:48079386-48079408 CTTGCTAGCCAGGCTGAAATAGG - Intergenic
907329725 1:53663159-53663181 GGGGCCACACAGGCTGAGATGGG - Intronic
907566381 1:55438578-55438600 GTTGACATGCTGGCTGAGAGCGG + Intergenic
907640482 1:56184183-56184205 GAAGCCATCCAGCCTGGGATGGG + Intergenic
909500179 1:76326096-76326118 GTTGCCATCCAGGCTGAGATCGG + Intronic
910864968 1:91779989-91780011 GTGACCATGCAGGCAGAGATTGG - Intronic
914869421 1:151460123-151460145 GCTCCAATCAAGGCTGAGATGGG + Intergenic
915310904 1:155005359-155005381 GATGCCATCCAGGCAGCCATAGG - Intronic
915770646 1:158419314-158419336 GTTTTCAGCCTGGCTGAGATTGG + Intergenic
916344719 1:163775095-163775117 GTTGCACTCCAGGTTGAAATTGG - Intergenic
919263367 1:195228241-195228263 CTTGCTATCCAGGCTGATATGGG + Intergenic
921591713 1:217011824-217011846 CTAGACATCCAGGCTGAGGTGGG - Intronic
921681988 1:218044585-218044607 TTCGCCATCCAGGGTGAGTTGGG + Intergenic
1063127421 10:3148028-3148050 GTTTCGATCCAGGCAGAGAGAGG + Exonic
1063950145 10:11214489-11214511 GTAGAAATCCAGGCTGGGATGGG + Intronic
1067659288 10:48222329-48222351 CTTGCCTTGCAGGCTGAGTTTGG - Exonic
1070509731 10:77149673-77149695 GTTAGGATGCAGGCTGAGATTGG - Intronic
1071513501 10:86282122-86282144 GTAGCCATGCAAGCTGAGAATGG - Intronic
1071823001 10:89297129-89297151 GTGGCCAGCTTGGCTGAGATTGG + Intronic
1075808726 10:125208988-125209010 GCTGCCGGGCAGGCTGAGATGGG + Intergenic
1076131605 10:128017638-128017660 GTGGCCACCGAGGCTGAGAGTGG - Intronic
1077046779 11:550211-550233 GTTGCCCTCCAGGGTGAGCATGG - Exonic
1077459156 11:2700170-2700192 GATGCCACCCGGGCTCAGATTGG + Intronic
1077939935 11:6830294-6830316 GTTGCCATCAAGGAAGAGAAGGG - Intergenic
1078839829 11:15068271-15068293 TCTGCCCACCAGGCTGAGATGGG + Intronic
1079057281 11:17217144-17217166 GCTGCCAAGAAGGCTGAGATGGG + Intronic
1079286866 11:19142121-19142143 GTTGACATCAAGGCTGAGCTTGG + Intronic
1080667570 11:34349275-34349297 GCTGTCATCCTGGCAGAGATGGG + Intronic
1081760107 11:45571168-45571190 AGTTCCTTCCAGGCTGAGATGGG + Intergenic
1081989917 11:47332285-47332307 GAAGCCATCCAGGCTGAGAGGGG + Intronic
1083570508 11:63759142-63759164 GTTCCCCCCCAGACTGAGATAGG - Exonic
1089980101 11:122765274-122765296 GGTGCCTTCCAGGCTGGAATGGG - Intronic
1090405801 11:126475274-126475296 GTTCCCATGCAGGCTGAGGCTGG - Intronic
1091974963 12:4817077-4817099 GCTGCCATCCTGGCTCACATGGG + Intronic
1092329107 12:7566534-7566556 GGTACCATCAAGGCTGAGAATGG + Intergenic
1097056894 12:56255752-56255774 GTTCCCATCCAGGCCCAGCTGGG - Intronic
1100716766 12:97314122-97314144 GTTCCCAGCCATGATGAGATGGG - Intergenic
1101324002 12:103698493-103698515 CTGCCCATCCAGGCTGACATAGG + Intronic
1102815874 12:115866015-115866037 GTTGCCATCTTGGCTGATCTCGG - Intergenic
1102929915 12:116854312-116854334 GTTGCCATCAAGGCTGGGCGTGG + Intergenic
1105852853 13:24351070-24351092 GTGGCCATCCAGGCAGAGTAGGG - Intergenic
1111030490 13:82591744-82591766 GGTGCCTCCCTGGCTGAGATGGG + Intergenic
1111351449 13:87036416-87036438 GTTCCCAGCCAGGATGGGATGGG + Intergenic
1113015572 13:105824534-105824556 GTTGCCATCCAAGCTGGCAGTGG - Intergenic
1114613769 14:24057843-24057865 GTTGCGAGCCAGGTTGAGGTAGG - Exonic
1115741427 14:36393016-36393038 GTTGACCTCCACCCTGAGATTGG + Intergenic
1117396957 14:55320334-55320356 TTTCCCATCTAGGCTGAGAAAGG - Intronic
1118977703 14:70691872-70691894 GTTCCCAGCCAGGATGGGATGGG - Intergenic
1120805426 14:88743114-88743136 GTGGCTATCAAGGCTGAGAGAGG + Intronic
1122706255 14:103624028-103624050 GTACCCAGCCAGGCTGAGCTTGG + Intronic
1122841583 14:104467071-104467093 GTGGCCATCCAGGCAGAGTAGGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124397228 15:29313519-29313541 GTTGTCATCCAGGCTTTGTTGGG - Intronic
1126545903 15:49873890-49873912 GTTTCCAACCAGTCTGAGAGAGG - Intronic
1127130328 15:55855592-55855614 GCTGCCATCCAGGCTGTGGCTGG + Intronic
1131562137 15:93454188-93454210 GCTGCCCTGGAGGCTGAGATGGG - Intergenic
1133935643 16:10267178-10267200 GTTGCCAGGCATGATGAGATGGG - Intergenic
1133998678 16:10766229-10766251 GGGGCCATCGAGGCTGAGAGCGG - Intronic
1137259409 16:46811915-46811937 TTTGTCACCCAGGCTGAGACAGG - Intronic
1137524575 16:49223581-49223603 GTTGCCTTCCAGGCAGATACTGG - Intergenic
1141134983 16:81459243-81459265 CTTGGCATCCAGGCTGTGAAGGG + Intronic
1148853285 17:50565070-50565092 GTCGCCATCCTGGCTGAGGCAGG - Intronic
1152159426 17:78658214-78658236 GCTGCCCTCCAGGGTGTGATGGG + Intergenic
1156119368 18:33823140-33823162 GCTGCCATTCAGGCTGACACAGG + Intergenic
1156770025 18:40708910-40708932 GTTGCCATGGAGGCAAAGATTGG + Intergenic
1156807660 18:41205649-41205671 GTTGTGATCCAGGATGAGAGGGG - Intergenic
1157538703 18:48483129-48483151 TTGGCCATCCAGGCCGTGATAGG + Intergenic
1160521549 18:79510986-79511008 GTTCCCAGCCAGGCTGGGAGTGG + Intronic
1161349654 19:3784826-3784848 GTTGGCATCCTGGCTGAGACGGG + Exonic
1161365434 19:3876578-3876600 GCTGCCAGGGAGGCTGAGATAGG + Intergenic
1164329955 19:24244719-24244741 TCTGCCCGCCAGGCTGAGATGGG - Intergenic
1165751603 19:38263941-38263963 TTTCCCATCCAGCCTGAGAGAGG - Intronic
1167777175 19:51565898-51565920 GCTGACATCCAGACTCAGATAGG - Intergenic
925006919 2:450735-450757 GTTGCAATCTGGGCTGAGACTGG + Intergenic
926563535 2:14444518-14444540 GTGCCCATCCAGGTTGAGGTGGG - Intergenic
927098376 2:19765673-19765695 GTGGGAATCCAGGCTGAGACTGG + Intergenic
927392429 2:22610422-22610444 GTTGGCATTCAGGCTGAAAATGG - Intergenic
927902288 2:26829239-26829261 GCTGCCTGCCAGGCTGAGATTGG - Intergenic
928640779 2:33296618-33296640 GTTGCCATCCCAGCTGAGCCTGG + Intronic
930156340 2:48111451-48111473 GTCGCCCTCCCGGCGGAGATTGG + Intergenic
930562242 2:52974220-52974242 ATTGCCATTCTAGCTGAGATCGG - Intergenic
934953163 2:98593055-98593077 GTTGCCCTCCAGGCTACGACAGG + Intronic
935406493 2:102715467-102715489 GGGGCCATCCAGCCTGAGTTTGG + Intergenic
936372148 2:111911122-111911144 GTTGCCACCCTGAATGAGATTGG + Intronic
937757109 2:125553131-125553153 GATGCCATTCAGGCTCAGAATGG - Intergenic
939390756 2:141566745-141566767 GTTACCCTGGAGGCTGAGATGGG + Intronic
939968890 2:148638474-148638496 GATGCCATCTAACCTGAGATAGG + Intergenic
942234446 2:173890347-173890369 GCTGCAATTCAAGCTGAGATTGG - Intergenic
945374813 2:209067709-209067731 GATGCCACCCTGGCTGGGATGGG + Intergenic
948596312 2:239081850-239081872 GTTCCCATCCAGGCAGACAGAGG - Intronic
1173545758 20:43896615-43896637 GTTGCCATTGAGGTTGAGACTGG - Intergenic
1175752451 20:61508718-61508740 GTGGCCACCCAGGCTGAGCCAGG - Intronic
1178568936 21:33716606-33716628 CTTGCCACCCACGCTGAGCTTGG + Intronic
1184840243 22:47048333-47048355 GGTGGCATCCAGCCTGAGGTCGG + Intronic
949316042 3:2756724-2756746 GTTACCATGGAGGCAGAGATTGG + Intronic
950037501 3:9897665-9897687 GTTGGCTTCCTCGCTGAGATTGG + Intergenic
952030947 3:29142056-29142078 TCTGCCATCCATGCTGAGCTTGG - Intergenic
952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG + Intergenic
958656797 3:97012433-97012455 GCTACCATGGAGGCTGAGATGGG - Intronic
959015162 3:101125242-101125264 GCTGCCATACATGCTGACATAGG + Intergenic
962177348 3:133168136-133168158 GTTCCCAGCCAGGATGGGATGGG - Intronic
969467319 4:7365414-7365436 GTTGGGGTGCAGGCTGAGATGGG + Intronic
978168686 4:105642061-105642083 ATTGACTTCCTGGCTGAGATGGG + Intronic
979223360 4:118255670-118255692 TCTGCCATCCTGGCTGAGACAGG + Exonic
979560848 4:122100414-122100436 GGGGCCTTCCAGGCTGAGTTTGG - Intergenic
980330041 4:131399717-131399739 TTTGCCATCCAGTGTGATATTGG + Intergenic
981494601 4:145377203-145377225 GTTCCCCCCCAGACTGAGATAGG - Intergenic
981547616 4:145910372-145910394 GTTGCCATTCCTGCTGAGACGGG - Intronic
983553890 4:169042863-169042885 GTTGCCATACAGCCAGAGAGGGG + Intergenic
983734424 4:171040304-171040326 ATTGCAATCCAGGCTCAAATTGG - Intergenic
984251658 4:177343267-177343289 GCTGCGATCCAGGATGAGAGAGG + Intronic
985371030 4:189285103-189285125 CTTGCCACCAAGTCTGAGATGGG - Intergenic
986960995 5:13212615-13212637 GTTACCATAAAGGCGGAGATGGG - Intergenic
987298001 5:16571145-16571167 GTTGCCATCAGGGAGGAGATGGG + Intronic
987735414 5:21835777-21835799 TTTGGCAGCCAGGCTTAGATTGG - Intronic
989406018 5:41061645-41061667 GTTGGCATCCAGTCTGGGGTAGG + Exonic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
993311590 5:86338881-86338903 GTTCTGAACCAGGCTGAGATGGG + Intergenic
993402209 5:87467514-87467536 GTGGCCAGCTTGGCTGAGATTGG - Intergenic
993620558 5:90162866-90162888 GTTCTGATCCAGGCTGAGAATGG + Intergenic
996935895 5:128947977-128947999 GTTGCAATAGAGGCTGAGGTGGG - Intronic
997393068 5:133532767-133532789 GTGGCCATCCTGGCTCAGAAAGG + Intronic
998183762 5:139963406-139963428 GATGCCAACCTGGTTGAGATAGG - Intronic
998783885 5:145688247-145688269 GTTGCCCTCCAGTCTGACTTTGG + Intronic
999182124 5:149677164-149677186 GTTGACATCCAGGATGGGAAAGG + Intergenic
1001401024 5:171446491-171446513 GAAGCCATCCATCCTGAGATTGG - Intronic
1001598636 5:172914722-172914744 CTTGACATTCAGGATGAGATGGG + Exonic
1003232216 6:4264646-4264668 GTCCCCATCCAGGTTGTGATGGG - Intergenic
1003738457 6:8905782-8905804 TTTACCATCCAAGCTGAGTTTGG - Intergenic
1004184668 6:13411704-13411726 CCTGCCATCCAGTCTGTGATAGG + Intronic
1004791774 6:19034636-19034658 GTTGCCATCCAGTCTTGGAGGGG - Intergenic
1010327334 6:74580093-74580115 GTTGCCAGGCAGGCAGAGATGGG + Intergenic
1015013453 6:128380065-128380087 GTTTACATCCAGGCTGAGCAGGG - Intronic
1015683643 6:135835021-135835043 GTTCCCATCCAGGCAGAGAAAGG + Intergenic
1018000075 6:159571128-159571150 GTTGCTTTCCAGGCAGAGTTTGG + Intergenic
1018391324 6:163343841-163343863 GATGCCATCCAGGCTGCCCTTGG - Intergenic
1019814447 7:3189421-3189443 GGAGCCACACAGGCTGAGATTGG + Intergenic
1021643113 7:22760612-22760634 GTTGACACCCAGGGTGAGAGGGG + Intergenic
1022531335 7:31068766-31068788 CTTGCCCTGCAGGCTGAGGTTGG + Intronic
1022890295 7:34689831-34689853 GTTGCCAGGGAGGCTGAGGTGGG + Intronic
1023079446 7:36513686-36513708 GTTGCCATCCAGCCTGAAGCTGG + Intronic
1023158353 7:37274137-37274159 CTTGGCAGGCAGGCTGAGATAGG + Intronic
1028638265 7:93015409-93015431 GTTGCCACCCGGGCTTAGATGGG - Intergenic
1029275048 7:99399013-99399035 GATGCCCTTCAGGATGAGATCGG + Intronic
1029862103 7:103583727-103583749 GTAGCCAGCATGGCTGAGATTGG + Intronic
1032061963 7:128732296-128732318 GCTACCAGGCAGGCTGAGATGGG + Intergenic
1036093787 8:5700374-5700396 GTTACTTTCTAGGCTGAGATAGG + Intergenic
1038519347 8:28216646-28216668 GCTGCCCTGGAGGCTGAGATGGG - Intergenic
1039842931 8:41306760-41306782 GTTCCAAGCCAGGCTGAGAAGGG + Intronic
1046016090 8:108607021-108607043 GTTGCCATGCAGGCAGAGGCAGG - Intronic
1046911206 8:119629531-119629553 GATGCCATAAAGGCTGGGATTGG - Intronic
1047232194 8:123007146-123007168 GTGGCCATGCAGGCAGAGATTGG - Intergenic
1047550937 8:125871582-125871604 GTGCCCACCCAGACTGAGATTGG + Intergenic
1058945137 9:109848805-109848827 GTTGTGATGGAGGCTGAGATGGG + Intronic
1060180443 9:121529972-121529994 GTTGCCATCCAGGCACACAGGGG + Intergenic
1060963822 9:127700497-127700519 GTTCCCAGCCATGATGAGATGGG + Intronic
1061290907 9:129649811-129649833 GGTGCCAGCCAGGGTGAGATGGG - Intergenic
1185509380 X:651733-651755 GTTGCCCCCCAGCCTTAGATCGG + Intronic
1185732488 X:2472655-2472677 GCTACCTTACAGGCTGAGATGGG + Intronic
1188171913 X:26938106-26938128 GTTGCCATCTAGGATAAGAGTGG + Intergenic
1188823043 X:34798131-34798153 TCTGCCCACCAGGCTGAGATGGG - Intergenic
1192753442 X:74019203-74019225 GTTCTTAACCAGGCTGAGATGGG + Intergenic
1193410851 X:81161042-81161064 CATGCCATCCAGGATGACATGGG - Intronic
1194437702 X:93888864-93888886 GTTGCAATTCAAGATGAGATTGG + Intergenic
1195322030 X:103728223-103728245 ATTGGCAGCCAGGCTGAGAAAGG - Exonic
1196860492 X:120023061-120023083 GGAGCAATCCAGGCAGAGATTGG - Intergenic
1197044704 X:121980784-121980806 GTTCCCACCCAGACTGAGAGTGG - Intergenic