ID: 909504202

View in Genome Browser
Species Human (GRCh38)
Location 1:76369539-76369561
Sequence CAGCTAGTAATGATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909504199_909504202 29 Left 909504199 1:76369487-76369509 CCAAGGAAGAAGCTGAGGCACAG 0: 1
1: 1
2: 23
3: 155
4: 714
Right 909504202 1:76369539-76369561 CAGCTAGTAATGATGGAGCTAGG 0: 1
1: 0
2: 4
3: 34
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909504202 Original CRISPR CAGCTAGTAATGATGGAGCT AGG Intronic
900535922 1:3177429-3177451 CAGCTAGTCAGGAACGAGCTGGG - Intronic
900880396 1:5377341-5377363 CATCTCGTATTGATGGAGCCAGG + Intergenic
901562924 1:10087250-10087272 AAACTAGAAATGATGGAACTGGG + Intronic
902276706 1:15345232-15345254 CAGCTAGGAAGGGTGGATCTGGG + Intronic
902415340 1:16235570-16235592 CAGCTAGCAGTGGTGGAGCCTGG + Intronic
903440128 1:23381591-23381613 CAGCTAATAATGGCAGAGCTGGG - Intronic
903570566 1:24301469-24301491 CAGCTGGTAAGGATAAAGCTAGG - Intergenic
904322150 1:29704839-29704861 CAGCTGTTAATGATGGAGCCAGG + Intergenic
904424684 1:30415770-30415792 CAGCAAGGAAGGAGGGAGCTGGG - Intergenic
905954805 1:41983567-41983589 CAGCTAATAAAGGTGCAGCTGGG + Intronic
907283763 1:53367630-53367652 CAGCTAGTAATGGCAGAGCCAGG + Intergenic
907334413 1:53690973-53690995 CAGCTAGCAGTGAAGGAGCAGGG + Intronic
907472668 1:54684287-54684309 TAGCTAGCAATGGTGGTGCTAGG + Intronic
907734620 1:57100099-57100121 TAGCTAGTGGTGATGGAGCTAGG - Intronic
907811160 1:57871450-57871472 CAGCTAGTAAGCTTAGAGCTGGG + Intronic
907834246 1:58093958-58093980 CAGCTAATAATGCAGGAGCCTGG - Intronic
908072354 1:60475746-60475768 CAGCCAGTAATGAAGGACCTAGG + Intergenic
909504202 1:76369539-76369561 CAGCTAGTAATGATGGAGCTAGG + Intronic
910474519 1:87592368-87592390 CAGGTAGTAAAGATGGAACCAGG - Intergenic
912380695 1:109246678-109246700 CAGCTAGTAATGGAAGAGCTAGG - Intergenic
912550361 1:110481503-110481525 TGGCTAGTAATGGAGGAGCTAGG + Intergenic
912731460 1:112110225-112110247 AAGCTAGAAATGATTAAGCTTGG - Intergenic
912753199 1:112302482-112302504 CAGATAATAATGACAGAGCTGGG + Intergenic
913068914 1:115282895-115282917 CAGATAGAAATGGGGGAGCTGGG + Intergenic
913510868 1:119560697-119560719 CAGCTAGAAGTGATAGTGCTAGG - Intergenic
914710937 1:150213229-150213251 CAGCTATAAATGGTGGAGTTAGG - Intergenic
915532627 1:156511811-156511833 CAGCTGGAAATGACTGAGCTGGG - Intergenic
915781813 1:158560431-158560453 ATGATAATAATGATGGAGCTTGG + Intergenic
918435901 1:184512667-184512689 AAGCTAGAAATGGTGAAGCTAGG - Intronic
919596285 1:199567231-199567253 AACTAAGTAATGATGGAGCTGGG - Intergenic
919738555 1:200968957-200968979 CAGCTAGTAAGGACAGAGCCAGG - Intergenic
921261053 1:213385386-213385408 CAGCTAGTAATGGTAAAGCCAGG + Intergenic
921514115 1:216068538-216068560 AAGCTAGTAATGCTGGTCCTTGG + Intronic
921621695 1:217332635-217332657 CATCTAGTACTTGTGGAGCTTGG - Intergenic
923882033 1:238114268-238114290 CAGGTAGAGATGGTGGAGCTGGG + Intergenic
923896220 1:238273043-238273065 CAGCTATTAGTGAGGGAACTTGG - Intergenic
924357399 1:243196296-243196318 CAACTACAAATAATGGAGCTGGG - Intronic
1064288193 10:14011061-14011083 CAGCTAGAAATGTCAGAGCTAGG + Intronic
1065120995 10:22530329-22530351 CAGCCTGGAATGATCGAGCTTGG - Intergenic
1066479198 10:35779127-35779149 AAGCTAGAAATGATTAAGCTTGG - Intergenic
1067334764 10:45351613-45351635 TAGCTAGTACTGATGAGGCTGGG - Intergenic
1068768801 10:60797464-60797486 CAGACAGAAATGGTGGAGCTGGG - Intergenic
1071462637 10:85913323-85913345 CAGCTATTAATGGTGTATCTGGG - Intronic
1073506079 10:103992090-103992112 CAGCAGGTAATAATTGAGCTCGG + Intronic
1074546688 10:114406677-114406699 CAGCAAGGAAGAATGGAGCTGGG + Intergenic
1075847765 10:125559296-125559318 AAGCTAGAAATGATTAAGCTTGG + Intergenic
1079063479 11:17270038-17270060 TAGCTAATATGGATGGAGCTGGG + Intronic
1079250231 11:18781608-18781630 GAGCTAATAAAGTTGGAGCTGGG - Intronic
1080259623 11:30333750-30333772 AAGCTAGAAATGATTAAGCTTGG + Intronic
1081186242 11:40046303-40046325 AAGCTAGAAATGATTAAGCTTGG - Intergenic
1081658874 11:44875680-44875702 GAGCTAGAAATGACTGAGCTGGG - Intronic
1082815055 11:57502288-57502310 CAGCTAGTAAGGCTGGTGGTGGG - Intronic
1086747600 11:90449661-90449683 GACCTAGGAATGATGAAGCTTGG - Intergenic
1088818427 11:113437061-113437083 CAGCTGGTAGGGATGGAGGTGGG + Intronic
1088833261 11:113556211-113556233 CAGCTAAGAATGGTGGAGTTTGG - Intergenic
1088902459 11:114128441-114128463 CAGCTAGAAGTGTTGGAGCTCGG - Intronic
1089402174 11:118170675-118170697 CAGCTTCTGATGCTGGAGCTGGG - Intronic
1090475328 11:127015006-127015028 CTGTTAGTAAGGATGAAGCTGGG - Intergenic
1090931555 11:131302076-131302098 TTGCTAATAATGATGGAGCTGGG - Intergenic
1091940899 12:4480828-4480850 CAGCTAGTAATGAAAGTGATGGG + Intergenic
1092076207 12:5675713-5675735 TAGCAAGTAATGACAGAGCTGGG - Intronic
1092412399 12:8263798-8263820 CAGCTAATAAGGATGGGTCTGGG + Intergenic
1092993830 12:13929066-13929088 CAGTTAGTAAGTATAGAGCTAGG + Intronic
1094548092 12:31423781-31423803 CAACTAGGAATGAGTGAGCTTGG - Intronic
1095180665 12:39144216-39144238 CAGCTTGCAATGATGGGGCGTGG - Intergenic
1095327196 12:40909325-40909347 CAACTAGTACTTATTGAGCTAGG + Intronic
1095631915 12:44386760-44386782 CAGCTAGTAATTTTGGAGCCAGG + Intronic
1096223000 12:49843829-49843851 CAGTTAGAAATGATGGTACTAGG + Intergenic
1097061973 12:56291973-56291995 CAGCTATTATTGATAGAGGTGGG + Intronic
1098213098 12:68186802-68186824 CAATTAGTGAAGATGGAGCTAGG - Intergenic
1099218369 12:79881217-79881239 AAGCTAGAAATGATTAAGCTTGG + Intronic
1100339539 12:93665172-93665194 CAGCCAGTAATGGTGGCACTGGG - Intergenic
1100639149 12:96464711-96464733 TAGCTAGTACTGGTGGAGCTGGG + Intergenic
1100735659 12:97526993-97527015 GAGCTAGTAAGCAAGGAGCTAGG + Intergenic
1101316668 12:103635262-103635284 CTGCTCGTGATAATGGAGCTGGG + Intronic
1101497433 12:105268008-105268030 TAGCTGGTAATGGTGGGGCTGGG - Intronic
1101813465 12:108128022-108128044 CAGCTGGTAATTATGGAGTTAGG + Intergenic
1101918402 12:108913500-108913522 CAGATAATAAGGATGGGGCTGGG + Intronic
1102243845 12:111342520-111342542 CAGCTGAAAGTGATGGAGCTGGG - Intronic
1103262103 12:119596351-119596373 CAGATATTAATGATGCTGCTTGG + Intronic
1103597100 12:122030563-122030585 CCGCTAGTGAGGGTGGAGCTGGG + Intronic
1105325035 13:19363119-19363141 AAGCTAGAAATGATTAAGCTTGG - Intergenic
1106524302 13:30526711-30526733 CATTTAGTGATGGTGGAGCTAGG - Intronic
1107954355 13:45496295-45496317 AAGTTAGTCATGATGGAGGTAGG + Exonic
1110030544 13:70606239-70606261 CAGTAAGCAATGAAGGAGCTAGG - Intergenic
1110683657 13:78346504-78346526 CAGCTGGTAATGACACAGCTGGG - Intergenic
1111975266 13:94960457-94960479 CAGCTAGTAATAATGGACCCAGG - Intergenic
1112045576 13:95593627-95593649 CAGCTAGTAATGAAGGAGCCAGG - Intronic
1117281323 14:54243992-54244014 CAGCTAGTAATGGTAGAGGTGGG - Intergenic
1118796471 14:69150286-69150308 CAGGAAGTACTGATGGAGATGGG + Intronic
1119206023 14:72794097-72794119 CAGCAAGTAAGCAAGGAGCTGGG - Intronic
1119680049 14:76585371-76585393 AGGCTAGGAATGATGGGGCTGGG - Intergenic
1119743949 14:77031126-77031148 CAGCCATTAGTGATGGGGCTGGG + Intergenic
1121089328 14:91170318-91170340 CAGCTAGAAATGGCTGAGCTGGG - Intronic
1121327106 14:93027516-93027538 CAGCTAATGATGAAGGAGCTGGG + Intronic
1121406417 14:93721795-93721817 GAGCTATTAATGATGAAGCAGGG + Intronic
1121820086 14:96959087-96959109 CAGCTAGAGAGGATGGAGCCTGG + Intergenic
1121964981 14:98295681-98295703 CAGCTAGGGATGAGGGTGCTGGG - Intergenic
1125088228 15:35757478-35757500 CAGTTGGAAATAATGGAGCTTGG - Intergenic
1125875368 15:43139450-43139472 AAGGTAGAAATGATGAAGCTTGG + Intronic
1126513025 15:49501901-49501923 CAGCTAGAACTGAAGCAGCTGGG - Intronic
1126684936 15:51240306-51240328 CAACTAGTAATGATGAAACTGGG - Intronic
1128323804 15:66710106-66710128 GAGCCAGTCATGGTGGAGCTGGG - Intronic
1128566274 15:68702202-68702224 CAGCTAGGAAAGGAGGAGCTGGG - Intronic
1128594590 15:68931825-68931847 CATTTAGTAATGTTGGAGTTTGG + Intronic
1130006875 15:80107992-80108014 CAGCTAGTAAGTGAGGAGCTGGG - Intronic
1131082685 15:89550013-89550035 AAGCTAGAGATGAAGGAGCTTGG + Intergenic
1131433258 15:92403221-92403243 CAGCTAGTAAACATGGAGCTGGG + Intronic
1132375189 15:101324105-101324127 CAACTAGTCATGATGGAGGTGGG - Intronic
1132420972 15:101668202-101668224 AAGCTAGAAATGATTAAGCTTGG - Intronic
1133856747 16:9556738-9556760 ATGATAGTAATCATGGAGCTGGG - Intergenic
1134095587 16:11416381-11416403 CAGCTGGTAATGACGGAGTGAGG - Intronic
1135121993 16:19774187-19774209 CAGCTGGAAGTGGTGGAGCTGGG - Intronic
1135844766 16:25909003-25909025 CAGCCAGCAATGATGGAGCAAGG - Intronic
1135932263 16:26748060-26748082 GAACTAATAATGATAGAGCTGGG - Intergenic
1137841912 16:51648822-51648844 CAGCAAGTAAAGGAGGAGCTTGG - Intergenic
1138377609 16:56576799-56576821 CAGCTAGTTCTGCTTGAGCTTGG - Intergenic
1138577434 16:57916947-57916969 CAGCTAGTTGTGGTGGAGGTGGG + Intronic
1138773534 16:59693103-59693125 CAGCTAGTACTTACAGAGCTGGG - Intergenic
1139665394 16:68451567-68451589 CAGCTAATAAGGCTGGAGGTGGG + Intergenic
1140209134 16:72957548-72957570 CAGGTAGTATTGGTAGAGCTCGG + Exonic
1140838971 16:78821301-78821323 CAGCTAGTTATGATGGAGGGTGG + Intronic
1140919187 16:79521003-79521025 CTGTTAGTAATGCTGGAGCCTGG + Intergenic
1140954164 16:79847042-79847064 AAGCTGGTAATGATGCACCTGGG - Intergenic
1141134468 16:81456663-81456685 CAGCTTGTAATTGTGGAGCGAGG + Intronic
1141730585 16:85820401-85820423 CAGCCAATAAAGCTGGAGCTGGG + Intergenic
1143729937 17:8875702-8875724 CAGGAAGGAATGATGGAACTGGG + Intergenic
1145013100 17:19381023-19381045 CAGCTCATCATGATGGTGCTGGG + Exonic
1145826897 17:27883775-27883797 CAGCTAATAAAGCTGGAGCTTGG + Intronic
1146094721 17:29918298-29918320 CAGCTAGAAATGGCAGAGCTGGG - Intronic
1146503178 17:33381783-33381805 CGGCTAGTAATGGAGGAGTTGGG - Intronic
1146775649 17:35612691-35612713 CAGCTAGTAGTAATGTAGCTAGG + Intronic
1147357676 17:39910513-39910535 CAGCTAGTAAGTGTAGAGCTGGG + Intronic
1147511415 17:41072123-41072145 CAGCTAGAAATGCAGCAGCTGGG - Intergenic
1147817155 17:43218297-43218319 CAGCCAGCCCTGATGGAGCTGGG - Exonic
1148357670 17:46986613-46986635 CAACTCCTAATGACGGAGCTTGG + Intronic
1150957718 17:69879297-69879319 CAGCCAGCAAAGATGGAGTTTGG + Intergenic
1153358785 18:4169887-4169909 TAGCTATGAATGATGGAGCAAGG - Intronic
1154274076 18:12944853-12944875 CTGCTAGTACTGCTGGAGCTAGG - Intergenic
1155344304 18:24843419-24843441 CAACTTGTGATGATGGAGCCTGG - Intergenic
1156956821 18:42976477-42976499 CTGCTAGTAATGCTGGAACCAGG - Intronic
1157189170 18:45566279-45566301 CAGCTAGAAATCATGGGGCCAGG + Intronic
1159414880 18:68132749-68132771 CAGATAGAAACTATGGAGCTAGG + Intergenic
1159665786 18:71158121-71158143 CATCTAGTAATTTTGGAGATAGG - Intergenic
1160097145 18:75884764-75884786 AAGCTGGGAATGATGAAGCTTGG - Intergenic
1160546472 18:79660090-79660112 AAGCTAGAAATGATTAAGCTTGG - Intergenic
1161859088 19:6784340-6784362 CAGCTGGGGATGAGGGAGCTGGG + Intronic
1163417688 19:17196329-17196351 CAGGTAGTAATGATGGATAGAGG + Intronic
1164527425 19:29022384-29022406 CAGCTGGTAAGGGTGGGGCTGGG + Intergenic
1164555345 19:29246832-29246854 CAGGTAAGAATGATGGGGCTAGG - Intergenic
1165726382 19:38115711-38115733 GAGCAAGTGATGATGAAGCTGGG - Intronic
1166793007 19:45408974-45408996 CAGATGGCAATGATGGAGCCAGG + Exonic
1168147559 19:54428593-54428615 CAGCTAGAAGTGCTAGAGCTGGG + Intronic
1168486529 19:56767376-56767398 CAACTAGTAATGACAAAGCTGGG - Intergenic
926317554 2:11722237-11722259 AGGCTAGGAAGGATGGAGCTGGG - Intronic
926359357 2:12071012-12071034 CTGTTGGTAATGGTGGAGCTTGG + Intergenic
926449995 2:12991351-12991373 AAGCTAGAAATGATTAAGCTTGG + Intergenic
929160846 2:38830699-38830721 GAGTTAGTAAGCATGGAGCTTGG + Intronic
929971177 2:46578434-46578456 CAGTTAATAATGGTGGTGCTGGG + Intronic
936583798 2:113732877-113732899 AAACTAGTAATGATGGAGATGGG + Intronic
937127427 2:119483351-119483373 GAGCTGGTGATAATGGAGCTGGG + Intronic
938022515 2:127917708-127917730 AAGCTAGAAATGATGAAGCTGGG - Intergenic
940325739 2:152423386-152423408 GAGCTGGTAATGATGGAGTTGGG + Intronic
942856144 2:180551352-180551374 CAGGTAGTAGTGATAGAGGTGGG + Intergenic
945036147 2:205705736-205705758 CAGATAGTAATCGTGGGGCTGGG + Intronic
946487027 2:220110609-220110631 CAGATAGTAATGACAGAGCTGGG + Intergenic
946678797 2:222191280-222191302 CAGCTAGTAATGGTGGAATCAGG - Intergenic
947346538 2:229196701-229196723 TAATTAATAATGATGGAGCTGGG - Intronic
948441922 2:237997604-237997626 TAGCCAGTAATCCTGGAGCTAGG + Intronic
1170601505 20:17844855-17844877 CAGCTAGTAATAGTGAATCTAGG - Intergenic
1170610349 20:17907678-17907700 CAGGCAGCAATGATGGATCTTGG - Intergenic
1171092196 20:22295916-22295938 CAGCTAGCAGAGGTGGAGCTGGG + Intergenic
1172075151 20:32290396-32290418 AAACTAGGAATGATAGAGCTGGG + Intronic
1172835869 20:37872615-37872637 CAGCTGGTAATGATGCAGTGGGG - Intergenic
1172900521 20:38331262-38331284 CAGTTAGTAAGTATGGAGCAGGG - Intronic
1173898541 20:46569450-46569472 CAGCTAGAAAAGATTAAGCTGGG - Intronic
1174211757 20:48884995-48885017 CAGCTAGGTATAATGGACCTGGG - Intergenic
1174520121 20:51122853-51122875 CAGCTAATAATAGTGGAGCCAGG - Intergenic
1174545656 20:51323191-51323213 CAGCCAGTAAGGAAGGAGCAAGG - Intergenic
1179122274 21:38559117-38559139 CAGCTAGGATTCATGGAGCAAGG - Intronic
1179879215 21:44286479-44286501 CCTCTAGTCATGATGGAGATGGG + Intronic
1181163424 22:20970965-20970987 CAGCCAGAAGTCATGGAGCTGGG + Intronic
1181750950 22:24988955-24988977 CAACTAGTGATTATGGAGCTGGG + Intronic
1182082398 22:27538644-27538666 CAGCTAGTTGTGAGGGAGCAGGG + Intergenic
1182710805 22:32322081-32322103 CAGCCACTGATGTTGGAGCTAGG + Intergenic
1183092587 22:35532968-35532990 CAGCAATAATTGATGGAGCTGGG - Intergenic
949430390 3:3969160-3969182 CACACATTAATGATGGAGCTAGG + Intronic
952872092 3:37909990-37910012 TCGCTAAAAATGATGGAGCTGGG - Intronic
953609980 3:44439483-44439505 CAGCTACTAATGCTGGGGCAGGG - Intergenic
954296916 3:49679391-49679413 CAGCAAGTTGTGATGGTGCTGGG + Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954850901 3:53599549-53599571 CAGCTTGTTATGGTGGAGCCAGG - Intronic
955463134 3:59207773-59207795 CAGCTCCCAGTGATGGAGCTTGG + Intergenic
955683401 3:61526071-61526093 CAGCTAGTAAAGATGGAAGCTGG + Intergenic
956618897 3:71200418-71200440 CAGCTAGTAATGGTGGAATCAGG + Intronic
956785647 3:72640093-72640115 CAGCTAGTAGTGGCAGAGCTGGG + Intergenic
960905108 3:122592810-122592832 CATTCAGTAATGGTGGAGCTGGG + Intronic
961511191 3:127404807-127404829 CAGCTAGTGAGTATGGAGCAGGG - Intergenic
962224670 3:133596043-133596065 TAGCTAGTAATGAAAGAGCCAGG + Intergenic
962392898 3:134988063-134988085 CAAATAGAAATCATGGAGCTTGG + Intronic
963303851 3:143627905-143627927 AAGCTGGTAATGAATGAGCTTGG + Intronic
963386394 3:144599669-144599691 AAGCTAGTAATCTTGGAGATAGG + Intergenic
964040909 3:152260897-152260919 CATCTAGAAATGAGGGAGTTAGG - Intronic
966287506 3:178315092-178315114 AAGCTATGAATGAAGGAGCTTGG - Intergenic
966865538 3:184257271-184257293 CAGCTAGGAGTGATAGAGCCAGG + Intronic
967017434 3:185494964-185494986 GAGCTGGTAATGATGGAGCTGGG + Intronic
967427933 3:189348977-189348999 CAGCTTGTATTGATGCAGCTAGG + Intergenic
967968929 3:194985146-194985168 CAACTGGTGATGCTGGAGCTGGG + Intergenic
969741620 4:9032526-9032548 CAGTTGGGATTGATGGAGCTGGG + Intergenic
969800986 4:9565429-9565451 CAGTTGGGATTGATGGAGCTGGG + Intergenic
971524949 4:27604992-27605014 AAGCTAGGAATGATTAAGCTTGG + Intergenic
973109749 4:46382772-46382794 GAGCTAGTAATGATAGAGCCAGG + Intronic
973899859 4:55457808-55457830 CAGCTATTAGTGATGAAACTGGG - Intronic
974667367 4:64981777-64981799 AAGTTAGAAATGATGAAGCTTGG + Intergenic
975834390 4:78406761-78406783 CAGCTGGAAACAATGGAGCTGGG + Intronic
976196872 4:82540957-82540979 CAGCTAGTAGAGACAGAGCTGGG - Intronic
976218705 4:82738928-82738950 CAGCTAGTAATAACAGAGGTGGG + Intronic
977566018 4:98581366-98581388 CATCTAGTAGTGATACAGCTGGG - Intronic
979244412 4:118483184-118483206 CAACTACAAATAATGGAGCTGGG + Intergenic
980706482 4:136503143-136503165 GAGCTAATAGTGATGGAGATGGG + Intergenic
981246186 4:142541854-142541876 CAGCCAATAATGCAGGAGCTGGG - Intronic
981468250 4:145098561-145098583 CAGCTGGAACTGATGGAGCGCGG + Intronic
981493025 4:145361317-145361339 AAGCTAGAAATGATTAAGCTTGG + Intergenic
982127804 4:152199526-152199548 CTGCTAGTAAGGGTGGAGCTGGG - Intergenic
984521596 4:180808677-180808699 CAGCCAGTAATGAAGGAGGAAGG - Intergenic
986018650 5:3780645-3780667 AAGGAAGTAATGATGGATCTTGG - Intergenic
993613677 5:90084583-90084605 CAGCTGGCAATGTGGGAGCTGGG + Intergenic
994018958 5:95002009-95002031 CAGCTGGTACTGAAGCAGCTGGG - Intronic
994668138 5:102732110-102732132 AAGATAGTAAGGATGGAGCCAGG + Intergenic
995074665 5:107968250-107968272 CAGCTATAAGTGATAGAGCTAGG + Intronic
996351976 5:122553983-122554005 AAGCTAGAAATGATTAAGCTTGG + Intergenic
997123768 5:131204174-131204196 CAGCTATTAATGATGTTGCGAGG - Exonic
997339459 5:133131419-133131441 CAGCAAGGAATGATGTTGCTAGG + Intergenic
997447627 5:133952943-133952965 CAGCTAGTACAGATGGGTCTGGG + Intergenic
998467704 5:142358721-142358743 CACCTAGAAATGATGGAGCAGGG + Intergenic
999124658 5:149238347-149238369 AGGCTAGTTATGGTGGAGCTGGG - Intronic
999273213 5:150310333-150310355 CAGCTAGGAAGGGTGGAGCTGGG - Intronic
999437228 5:151572264-151572286 CAACTAGTATTGATTGAGCCTGG - Intergenic
999505286 5:152188306-152188328 CAGGTAGTAGTGATAGAGCCAGG + Intergenic
999719320 5:154386927-154386949 TAGCTCCTGATGATGGAGCTGGG - Intronic
1000657489 5:163898425-163898447 AAGCTAGAAATGATTAAGCTTGG + Intergenic
1001044457 5:168361190-168361212 CAGCTAGGAAGGATGGAACTGGG + Intronic
1001475352 5:172046538-172046560 CAACTAGTAATGGAGGAGTTAGG + Intronic
1004186806 6:13428045-13428067 CAGCTTGTGTTGATGTAGCTCGG - Intronic
1006255140 6:32826692-32826714 CAGCTAATCATGATAAAGCTGGG - Intronic
1007222439 6:40289683-40289705 GAGTTGGCAATGATGGAGCTGGG - Intergenic
1007286374 6:40750763-40750785 CATCTATAAATGAGGGAGCTGGG - Intergenic
1007812820 6:44498284-44498306 CAGCTAGGAAGTAGGGAGCTGGG + Intergenic
1009592168 6:65686871-65686893 AAGCTAGAATTGATGGGGCTTGG + Intronic
1010578419 6:77563255-77563277 CAGCTGGTAATGATGGTTATAGG - Intergenic
1011641982 6:89424289-89424311 CAGATACTAAGGATGGAGTTAGG - Intergenic
1011712279 6:90066875-90066897 CAGCTAATAAGAATGGAGCCCGG - Intronic
1011845026 6:91552459-91552481 CAGCTAGTGCTGAAGCAGCTGGG + Intergenic
1014298511 6:119650927-119650949 CATCTAGTAGGGAAGGAGCTGGG + Intergenic
1015829302 6:137350682-137350704 TAGCTAGTAAACAAGGAGCTGGG - Intergenic
1016112053 6:140236431-140236453 CATATAGTTATAATGGAGCTGGG + Intergenic
1019200285 6:170308181-170308203 CACTCACTAATGATGGAGCTGGG - Intronic
1019824397 7:3271806-3271828 CAGCTAGTAAAGGCGGAACTAGG + Intergenic
1021638717 7:22717220-22717242 AAGCTGTAAATGATGGAGCTGGG + Intergenic
1022062010 7:26806530-26806552 AAGCTAGAAATGATTAAGCTTGG + Intronic
1022781643 7:33590869-33590891 AAACTAATAATCATGGAGCTGGG + Intronic
1027173422 7:75888669-75888691 CAGGGAGGAATGGTGGAGCTGGG - Exonic
1028554175 7:92104599-92104621 AAGCCAGTAGTGATAGAGCTAGG + Intronic
1029337895 7:99918077-99918099 TAGCTTGTAATGATGAGGCTGGG - Intronic
1030076620 7:105742565-105742587 CAACTAGAAATGTTGGAGCTGGG + Intronic
1031066414 7:117110527-117110549 CAGCTAGCAATGGAGGAGCAGGG + Intronic
1031735870 7:125360758-125360780 AAGCTAAAAATGATTGAGCTTGG - Intergenic
1031860206 7:126970756-126970778 AAGCTAGAAATGATGAAGCTTGG - Intronic
1033139893 7:138816615-138816637 AAGCTAGAAATGATTAAGCTTGG + Intronic
1034104488 7:148478567-148478589 AAACTTTTAATGATGGAGCTGGG + Intergenic
1035745358 8:1958726-1958748 CAGCAAGTGGTGATGCAGCTAGG - Intergenic
1036029129 8:4946375-4946397 CACCTAGTGATGAAGGAACTAGG + Intronic
1036253987 8:7189287-7189309 CAGTTGGGATTGATGGAGCTGGG - Intergenic
1036363505 8:8098192-8098214 CAGTTGGGATTGATGGAGCTGGG + Intergenic
1036887445 8:12568877-12568899 CAGTTGGGATTGATGGAGCTTGG - Intergenic
1036895043 8:12626978-12627000 CAGTTGGGATTGATGGAGCTGGG - Intergenic
1039701818 8:39969899-39969921 AAGCTAGAAATGATTAAGCTTGG + Intronic
1040082687 8:43304394-43304416 CAGCTGTTCATTATGGAGCTAGG + Intergenic
1041098616 8:54373855-54373877 CATCTTGTAAACATGGAGCTGGG - Intergenic
1042655255 8:71088775-71088797 CAGCCAGGAAGAATGGAGCTGGG - Intergenic
1042864940 8:73348930-73348952 CGGCTAGTAAGTTTGGAGCTGGG + Intergenic
1044167491 8:89005061-89005083 AAACTAGTGATGATGTAGCTGGG + Intergenic
1049896558 9:115316-115338 CAGCTACCAAAGATGGGGCTTGG + Intergenic
1050361425 9:4834900-4834922 CTGCTAATAATGACAGAGCTAGG + Intronic
1050503618 9:6324460-6324482 CATATATTATTGATGGAGCTGGG + Intergenic
1057643729 9:96853786-96853808 AAGCTAGCAGTGAGGGAGCTGGG - Intronic
1057730517 9:97604500-97604522 CAGCTAGCAATGGTGAAGCCAGG + Intronic
1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG + Intronic
1057962929 9:99474197-99474219 CAGATATTAATAATGGAACTTGG - Intergenic
1058758775 9:108109193-108109215 CAGCTGCTAATTATGGAGCCAGG + Intergenic
1058867982 9:109179250-109179272 GATCTAGCATTGATGGAGCTGGG - Intronic
1059050189 9:110916291-110916313 CAGCTAGGAATGACGGAGCTGGG + Intronic
1059139631 9:111840786-111840808 TAGCAAGTGATGATGGAGCTAGG - Intergenic
1059246321 9:112852643-112852665 CAGCTAGCACTGGTAGAGCTAGG + Intronic
1059284738 9:113162690-113162712 GAGCTGGTAATGAGGAAGCTGGG - Intronic
1060837891 9:126770962-126770984 CAGCTAATAAATGTGGAGCTGGG - Intergenic
1186649331 X:11541726-11541748 CAGCTAGTAGTGGTGGCTCTAGG - Intronic
1188442257 X:30223933-30223955 CTGCTAGTAATGACAGGGCTGGG + Intergenic
1188591416 X:31840985-31841007 AAGCTAGAAATGATTAAGCTTGG + Intronic
1188855607 X:35191547-35191569 AAGCCAGAAATGATTGAGCTTGG - Intergenic
1190736360 X:53257902-53257924 CAGCTACTAATGATAGAGCCAGG + Intronic
1191869566 X:65734457-65734479 CAGCTAAAAATGGTAGAGCTGGG + Intronic
1192019393 X:67369204-67369226 TAGCTAGTAATGGTAGTGCTGGG - Intergenic
1192676355 X:73200843-73200865 TAGCTAGAAATGATTAAGCTTGG + Intergenic
1192961246 X:76133398-76133420 TAGCTAGTAATGATATTGCTGGG - Intergenic
1194912598 X:99665189-99665211 TACCTAGTAATGATGTTGCTGGG + Intergenic
1194940227 X:100000312-100000334 AAGCTAGAAATGATTAAGCTTGG + Intergenic
1196696870 X:118622737-118622759 TAGCTAGTAATGGGAGAGCTGGG + Intronic
1198581098 X:138065438-138065460 CAGCTAGTAAGAACAGAGCTGGG + Intergenic
1199849785 X:151717265-151717287 TCTCTAGAAATGATGGAGCTTGG + Exonic
1199953294 X:152722826-152722848 CAGCTGGTGATGATGGTGCCAGG - Intergenic
1199956388 X:152745624-152745646 CAGCTGGTGATGATGGTGCCAGG + Intergenic
1200019159 X:153187765-153187787 CAGCTGGTGATGATGGTGCCTGG - Intergenic
1200767142 Y:7089801-7089823 CAGCGAGGACTGATGGAGGTGGG - Intronic