ID: 909508970

View in Genome Browser
Species Human (GRCh38)
Location 1:76429267-76429289
Sequence TAGATCATACAGATAGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909508970 Original CRISPR TAGATCATACAGATAGGACA TGG (reversed) Intronic
904450786 1:30609958-30609980 TAAATAAGACAGACAGGACAGGG - Intergenic
904996704 1:34636837-34636859 AAGATCATAAAGTTAAGACAGGG + Intergenic
906700051 1:47851113-47851135 TAGAACATTCATATAGAACAGGG - Intronic
906719427 1:47994774-47994796 AAGATCATACATCTAAGACAGGG - Intronic
906874486 1:49522217-49522239 AAGGTCATACAGATAGTAAATGG - Intronic
907042204 1:51272079-51272101 TAGATAAAACACATAGGAAAGGG - Exonic
907698708 1:56761139-56761161 AAGATCATACAGACAGGATGAGG - Intronic
908784285 1:67719772-67719794 AAGATCATACAGCTATTACATGG + Intronic
909508970 1:76429267-76429289 TAGATCATACAGATAGGACATGG - Intronic
909922977 1:81404222-81404244 AAGATCATACAGCTAGTAGATGG - Intronic
910167402 1:84341930-84341952 TTGCTCATACAGATAGTCCAAGG + Intronic
911616637 1:100019752-100019774 TAGAGAAGACAGATATGACATGG - Intronic
912718079 1:111996181-111996203 AAGATCAATCAGATAGGACCTGG - Intergenic
920944356 1:210514690-210514712 GAGATGAGACAGAAAGGACAAGG + Intronic
922083912 1:222326636-222326658 TAGAGCATACTCATAGTACACGG + Intergenic
923284397 1:232478279-232478301 TAGAAAATTCAGAAAGGACAAGG + Intronic
924319279 1:242831153-242831175 AAGATCACACAGGTAGAACATGG + Intergenic
1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG + Intronic
1068130149 10:52886439-52886461 AAGATCACACAGCTAGGATAAGG + Intergenic
1069735051 10:70648494-70648516 TACAGCAAACAGATTGGACATGG + Intergenic
1074180260 10:111055952-111055974 AAGAAAATACAGGTAGGACATGG - Intergenic
1075283594 10:121162909-121162931 TAGATCATACACATATAGCAGGG + Intergenic
1076683033 10:132185080-132185102 GAGATCAGACAGTTAGGAAAGGG + Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079425611 11:20339653-20339675 AAGATAAAACAGATAAGACATGG + Intergenic
1080774642 11:35373975-35373997 AAGATCACACAGCTAAGACACGG - Intronic
1081480382 11:43481686-43481708 CAGATCCTACAGATAGTAAAAGG - Intronic
1081857347 11:46312240-46312262 CAGGTCATATAGATAGCACATGG + Intronic
1084513933 11:69625426-69625448 TCGATCTTAAAGTTAGGACAAGG + Intergenic
1085374140 11:76042760-76042782 TATAACATACAGATAGGTAAGGG - Intronic
1085789179 11:79482014-79482036 AAGGTCATACAGACAGGAAAAGG - Intergenic
1086049530 11:82573246-82573268 CAGATCATACAGCTAGAATATGG + Intergenic
1087135511 11:94713864-94713886 AAGATCATACAGAATGGAAAGGG - Intronic
1087831943 11:102827837-102827859 AAGGTCATACAGATAGTAAATGG - Intergenic
1091651839 12:2316239-2316261 AAGACCATACAGATAAGAGATGG - Intronic
1092827172 12:12411761-12411783 TAGATCTTACATTTAGGTCATGG + Intronic
1095215695 12:39544679-39544701 TAGATTATGAAGATAGGAAAAGG + Intergenic
1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG + Intronic
1098528702 12:71516009-71516031 TATATCATAGAGATAGGTCAGGG - Intronic
1099214783 12:79840140-79840162 AAGATCATACAGGTAGGAAGTGG - Intronic
1100066972 12:90660533-90660555 GAGATCACACAGATAGTAAAAGG + Intergenic
1100894658 12:99167881-99167903 TAGTTCATACACACAAGACATGG + Intronic
1101235420 12:102784064-102784086 TTGGTCATACAGCTAGCACATGG - Intergenic
1109342043 13:61075005-61075027 TAGATGATATAGATTGGAGAGGG + Intergenic
1109614870 13:64819629-64819651 TAGGTCAAACAGATAGTATATGG + Intergenic
1111111588 13:83716884-83716906 TAGATTATACAGCTAATACATGG - Intergenic
1112448051 13:99484740-99484762 TGGTTCTTACAGATAGGACTTGG - Intergenic
1112492536 13:99880473-99880495 TGGATCACACAGCTAGGAAAAGG + Intronic
1112860376 13:103823609-103823631 TATATAATACAGGTAGGACATGG + Intergenic
1113012453 13:105785412-105785434 TAGATCACACAGCCAGCACATGG - Intergenic
1113136479 13:107095871-107095893 GAGATCATGGAGTTAGGACATGG + Intergenic
1114758928 14:25290109-25290131 AAGATTATACAGCTAGTACAGGG + Intergenic
1118161452 14:63294736-63294758 TAAGTCATACACATATGACAAGG + Intergenic
1120307627 14:82790563-82790585 TTGATCATACAGAAAAGAGAAGG + Intergenic
1120762336 14:88296275-88296297 AAGGTCATACAGTTAGGAAATGG - Intronic
1121205009 14:92157210-92157232 TAAATAATACAGATAGGGCCGGG + Intronic
1121630929 14:95421476-95421498 TAGATCACACATCTAGGACGTGG - Intronic
1128042459 15:64587350-64587372 TAGGTACTACAGATATGACACGG - Intronic
1129275507 15:74442751-74442773 TGGATCCTCCAGATGGGACATGG - Intergenic
1129637815 15:77341094-77341116 TAAAAAATACACATAGGACAAGG + Intronic
1138973091 16:62170403-62170425 TAGGACATACACAAAGGACAAGG - Intergenic
1139630287 16:68227606-68227628 TAGATCATACAGACAGGACAGGG - Exonic
1140414281 16:74762492-74762514 TATTTCATAGACATAGGACAAGG - Intronic
1141924880 16:87161576-87161598 TAGGTCACACAGCTAGGAAATGG - Intronic
1144363381 17:14518359-14518381 TAGATCCTACAAATTGGACTAGG - Intergenic
1148173622 17:45545378-45545400 TTTATCATACAAATAGTACATGG - Intergenic
1148275647 17:46300070-46300092 TTTATCATACAAATAGTACATGG + Intronic
1148297757 17:46517638-46517660 TTTATCATACAAATAGTACATGG + Intronic
1150404829 17:64892302-64892324 TTTATCATACAAATAGTACATGG - Intronic
1155528733 18:26744208-26744230 TAGAGCAATCAGAGAGGACATGG - Intergenic
1155818291 18:30344105-30344127 CAGATCAGACAGTTTGGACATGG + Intergenic
1155891324 18:31273475-31273497 TAAAGCATTCAGATAAGACAGGG + Intergenic
1157028626 18:43877335-43877357 TAGGCCATACAGCTAGGAAATGG - Intergenic
1157857881 18:51118062-51118084 GAGACCATGCAGAGAGGACAGGG + Intergenic
1159242373 18:65758882-65758904 TAGATACTACAGATACGATAGGG + Intronic
1163047340 19:14653798-14653820 CAGATCAAACAGTTAGGACGTGG + Intronic
1163228866 19:15985069-15985091 GAGATATTACAGATAAGACAAGG - Intergenic
1166019827 19:40016791-40016813 TATATCATAAAGATAGGCCAAGG - Exonic
928865184 2:35909302-35909324 AAAATCATACAGCTAGGAAACGG + Intergenic
932988683 2:76760147-76760169 GAGATCGTACAGAAAGGAAAAGG - Intronic
933081677 2:77996351-77996373 TAGAACAGATAGAAAGGACAGGG - Intergenic
934855537 2:97727116-97727138 AAGATCAGTCAGAGAGGACAGGG + Intronic
937503630 2:122511539-122511561 TAGATCACAAAAACAGGACAGGG - Intergenic
940345189 2:152621359-152621381 TAGATCAATCACACAGGACATGG - Intronic
940545756 2:155082542-155082564 TTAATCATACCAATAGGACAAGG - Intergenic
940573740 2:155472701-155472723 TTAATCATACCAATAGGACAAGG - Intergenic
942951094 2:181722953-181722975 AAGATCATAGAGACAGTACAAGG + Intergenic
943896946 2:193375739-193375761 TAGATCTTACAGATATCAAAAGG - Intergenic
946766667 2:223046920-223046942 CAGATCACACAGCTAGTACATGG - Intergenic
1171200292 20:23235290-23235312 GAGTTCTTACAGACAGGACAAGG - Intergenic
1173446000 20:43118795-43118817 AAGATCACACAGCTAGTACATGG + Intronic
1174227384 20:49013002-49013024 AAGGTCATACAGCTAGGACCTGG - Intronic
1174940912 20:54926118-54926140 TAGAATATACAGATAGGCAATGG - Intergenic
1177401916 21:20615506-20615528 TGGACAATACAGATAGTACATGG - Intergenic
1177554291 21:22669850-22669872 TAGATAATACAGATATCAAAAGG + Intergenic
953545175 3:43859151-43859173 AAGATCACACAGCTAGAACATGG + Intergenic
954946317 3:54427769-54427791 AAGGTCAGACAGGTAGGACATGG + Intronic
956423534 3:69109911-69109933 AAGATCATACAGCTAGGAAGTGG + Intronic
959101945 3:102020666-102020688 TGGATGGTTCAGATAGGACAAGG - Intergenic
959417039 3:106087958-106087980 TAGATTACACATATAAGACAAGG + Intergenic
960872434 3:122263281-122263303 AAGATCACACAGCTAGGAAATGG - Intronic
963226120 3:142863488-142863510 TTGATCAGATAGATGGGACATGG + Intronic
968315741 3:197723522-197723544 TTGATCATAAAGATAGGAAAAGG + Intronic
969846630 4:9924814-9924836 TAGATCAGACAAATCAGACACGG - Intronic
970850370 4:20595505-20595527 TAGATCACAGTGATAGAACATGG + Intronic
973004689 4:44992565-44992587 TAGATAATCCAGATAGAATATGG + Intergenic
973140458 4:46761238-46761260 TAGGTTGTACAGATAGAACAGGG - Intronic
974158556 4:58106072-58106094 TAGATCATAAATATGAGACAGGG - Intergenic
974593988 4:63993951-63993973 TGGATCATGCGGAGAGGACATGG + Intergenic
974800485 4:66811718-66811740 AAGATTATACAGATAGGGCCGGG + Intergenic
976410009 4:84702772-84702794 TAGATTTTAAAGAGAGGACAAGG + Intronic
976434023 4:84995996-84996018 TAGAGGATACAGAGAGAACAGGG + Intergenic
976691190 4:87868891-87868913 TATATCATACAGAGAGGAATAGG - Intergenic
977310831 4:95384958-95384980 GAGAATGTACAGATAGGACAGGG + Intronic
978194569 4:105956141-105956163 TAGATCATACAGTTAGAAGATGG - Intronic
978815001 4:112894016-112894038 AAGGTCATACAGACAGGAAACGG + Intronic
981588088 4:146326274-146326296 TGGATCATACAGATAGAAGCTGG + Intronic
983043241 4:162955234-162955256 CAGATCAAACAGATAAGAAATGG + Intergenic
983159601 4:164395411-164395433 TAGAAGATACATATAGGAAATGG + Intergenic
984925159 4:184800031-184800053 TATATCATACAGTTAGTAGAAGG - Intronic
986954535 5:13135427-13135449 TTGATAGTACAGGTAGGACATGG - Intergenic
987397376 5:17437549-17437571 TAGATCAAATGGAAAGGACAAGG + Intergenic
987686568 5:21211717-21211739 TAGATCATGCAAATAGTAAATGG - Intergenic
989336105 5:40318820-40318842 AAGATCATACAGCTAGAAAATGG - Intergenic
990311101 5:54539662-54539684 TAGAGCACACTGATAGAACAGGG - Intronic
991185242 5:63799151-63799173 AAGATCATACAGTTGGGATATGG - Intergenic
991257650 5:64632572-64632594 TAGATCATACTGATAGGGTTAGG - Intergenic
992064206 5:73090562-73090584 TATATCATAATGTTAGGACAAGG + Intergenic
995900156 5:117056328-117056350 TAGAACATAAAGAGAGGATAGGG - Intergenic
999249268 5:150172484-150172506 AAGCTCATACAGCTAGGACATGG + Intronic
999263403 5:150251310-150251332 TAGATCACACAGCTAAGAAATGG - Intronic
999700455 5:154223346-154223368 CAGTTCGTACAGCTAGGACATGG + Intronic
1000772998 5:165380245-165380267 TATATCACACATATAGGAAAAGG - Intergenic
1002419466 5:179138089-179138111 CAGGTCTTACAGCTAGGACATGG - Intronic
1006225905 6:32535732-32535754 GAGAGCATAGAGACAGGACAGGG + Intergenic
1007839446 6:44704015-44704037 AAGATCAAACAGAGAGTACATGG + Intergenic
1010252345 6:73721058-73721080 TACATAGTACAGGTAGGACAAGG - Intronic
1016706154 6:147110603-147110625 TAGAGCCTTCAGAAAGGACAAGG + Intergenic
1020410423 7:7886121-7886143 TTGATTATGCAGATAAGACATGG - Intronic
1021817420 7:24461271-24461293 TAGATCATACATATAAAATAAGG - Intergenic
1027252682 7:76408915-76408937 AAGGTCATACAGCTAGGAGATGG - Intronic
1028232212 7:88319230-88319252 AAGATAACATAGATAGGACAGGG + Intergenic
1034044059 7:147908876-147908898 TAGATCACACAGAAAGGAAGTGG - Intronic
1034930819 7:155161898-155161920 TAGGTCATAAAGATGAGACAAGG - Intergenic
1034984483 7:155499487-155499509 TACATAATAGAGAGAGGACACGG - Intronic
1036020019 8:4834142-4834164 TAATTCATACAGATAAAACAAGG + Intronic
1036404452 8:8442270-8442292 CAGAGCATGCAGAAAGGACAAGG + Intergenic
1037021332 8:13975214-13975236 TAGAACAAACAGAGAGGATAAGG + Intergenic
1044021488 8:87110989-87111011 TATAAAATACAGATAGGTCATGG - Intronic
1045819178 8:106315286-106315308 TATATAAAACACATAGGACAAGG + Intronic
1047873019 8:129106033-129106055 AGGATCATAGAGATAGGAAATGG - Intergenic
1049030551 8:140034001-140034023 TAGATCTTACAGATGTGAAAAGG - Intronic
1049129238 8:140822018-140822040 CAGAGCATGCAGATTGGACATGG + Intronic
1052252086 9:26410337-26410359 TAGATAATCCATATAGGAAATGG + Intergenic
1052748180 9:32462096-32462118 TAGATCACACAGCTAGTTCATGG - Intronic
1055541585 9:77311912-77311934 TAGATCAAAAAGAAATGACAAGG + Intronic
1059553916 9:115259346-115259368 GAGATCATACAGCTAGTAAATGG + Intronic
1060369207 9:123053599-123053621 TATATTGTAAAGATAGGACATGG + Intronic
1186312337 X:8334550-8334572 GATATCATACTGATAGGACCTGG - Intergenic
1192038034 X:67587117-67587139 AAGATCATACAGCTAGGAAGTGG + Intronic
1192226873 X:69234963-69234985 AAGGTCATATAGCTAGGACATGG - Intergenic
1195887537 X:109655783-109655805 TAGATCATACACAAAGGAATGGG + Intronic
1198152343 X:133923330-133923352 CTGATCAGAGAGATAGGACATGG + Intronic
1200087045 X:153612044-153612066 TAGAGAAAACAGAAAGGACAAGG - Intergenic
1200418503 Y:2937022-2937044 TGGATAATATAGATAGGAAAGGG + Intronic
1200931481 Y:8700998-8701020 TGGATCTCACAGATAAGACAGGG + Intergenic