ID: 909512808

View in Genome Browser
Species Human (GRCh38)
Location 1:76474103-76474125
Sequence ATGTGTTGACTGAGGCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909512808 Original CRISPR ATGTGTTGACTGAGGCAAGC TGG (reversed) Intronic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
904947174 1:34208014-34208036 ATGGGCTGTCTGAGGCCAGCTGG - Intronic
907343654 1:53756110-53756132 ATGAGGTGAGTGAGGCCAGCTGG - Intergenic
908878600 1:68705660-68705682 ATCAGTTGACTGAGGCACCCTGG - Intergenic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
909520823 1:76565643-76565665 ATGTGTTAATTGAGGCTAACAGG + Intronic
909976590 1:82052795-82052817 ATGTGTTGATTGAGCCCAGCTGG + Intergenic
910065172 1:83143320-83143342 GTATGGTGACTGTGGCAAGCTGG + Intergenic
911885364 1:103290887-103290909 ATGAGTTGAGTGAGGCTAGAGGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
916474255 1:165153570-165153592 CTGTCTTGGCTCAGGCAAGCAGG + Intergenic
917654981 1:177117235-177117257 ATGGGAGGACTGAGGAAAGCTGG - Intronic
917656360 1:177130213-177130235 CTTTGTTGACTGAGACAAGGTGG - Intronic
922597145 1:226822871-226822893 ATGTGATGACTGAAACAAGAGGG - Intergenic
1063002879 10:1941127-1941149 ATCTCTTCACTGAGGCAATCGGG + Intergenic
1064766726 10:18682888-18682910 ATGTGTTGACAGAAGCCAGATGG - Intergenic
1066188978 10:33037849-33037871 GTGTGCTGGCTGAGGCAGGCTGG - Intergenic
1067824228 10:49558323-49558345 CTGTGTGGAGTGAGGTAAGCTGG + Intergenic
1069121649 10:64576300-64576322 ATCTTTTGACTGAGTAAAGCAGG - Intergenic
1070487295 10:76943111-76943133 AGGAGTTGAAAGAGGCAAGCCGG - Intronic
1073744598 10:106451794-106451816 ATGGGAAGACTGAGGGAAGCAGG + Intergenic
1076458931 10:130625320-130625342 ATGTGTTGACTGAGGTATTTAGG + Intergenic
1077399214 11:2345197-2345219 ATCTGTGGACTGAGAAAAGCAGG + Intergenic
1079029371 11:16974513-16974535 ATGTTATCACTGAGGGAAGCTGG - Intronic
1079724503 11:23864338-23864360 AAGTGTTGCCTGATGAAAGCAGG - Intergenic
1079793743 11:24772303-24772325 GTGTGTTTATTGAGGCAAGAAGG - Intronic
1083640911 11:64144790-64144812 ATGTGTTTGCTGAGGCTTGCCGG - Intronic
1083641684 11:64149075-64149097 ATGGGTAAACTGAGGCAAGCAGG + Intronic
1083929129 11:65829783-65829805 CTGTGGCGACTGAAGCAAGCAGG - Intronic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1085551690 11:77379347-77379369 ATTTGATGTCTGAAGCAAGCGGG + Exonic
1088733309 11:112703294-112703316 ATGTGTTGAGGGAGGCAGGTTGG + Intergenic
1089048689 11:115526892-115526914 ATATGTTAACTGAGGGAGGCTGG - Intergenic
1090527711 11:127555517-127555539 TTGTGTTGACAGATGCAGGCAGG - Intergenic
1096862570 12:54540391-54540413 ATGTGTTTGGTGAGGCAAGAGGG + Intronic
1102336544 12:112085482-112085504 ATATGTTAATTGAGACAAGCAGG - Intronic
1104753829 12:131256552-131256574 CTGGGTTCACTGAGGCAGGCGGG - Intergenic
1105025067 12:132842771-132842793 ATCTGTTGTCTGAGGCATCCGGG - Intronic
1105947504 13:25202380-25202402 ATAGGTTGACTGAGGGAAGATGG - Intergenic
1109411148 13:61971108-61971130 ATGTGAGGACAGAGACAAGCAGG - Intergenic
1112395257 13:99024177-99024199 ATGTGTTCACTGATGCTAGACGG - Intronic
1112899355 13:104340042-104340064 TTGTGTATACAGAGGCAAGCAGG - Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1117407021 14:55413781-55413803 ATGTGCTTACTGAGCCAGGCTGG - Exonic
1120244130 14:81986029-81986051 ATGTTCTGAGTGAGGCATGCTGG - Intergenic
1124021974 15:25933582-25933604 ATGTGTTAACTGAGGCCACATGG + Intergenic
1125383816 15:39115276-39115298 GTATGGTGACTCAGGCAAGCTGG - Intergenic
1125765982 15:42136699-42136721 ACGTGTTGAGTGAGAGAAGCTGG + Intergenic
1126825743 15:52546179-52546201 AGGTGCTGACTGTGGCAGGCAGG + Intergenic
1127674194 15:61225291-61225313 ATTTGTTCACTGTGGCGAGCCGG + Intronic
1127841840 15:62838528-62838550 GTGTGTTAACAGAGGCATGCCGG - Intronic
1129326771 15:74803919-74803941 ATGTATTCCCTGAGGCAGGCAGG + Intergenic
1130475312 15:84261080-84261102 ATGGGTTAACTGAGGATAGCTGG + Intergenic
1130482729 15:84375134-84375156 ATGGGTTAACTGAGGATAGCTGG + Intergenic
1134729416 16:16448689-16448711 ATGGGTAGACGGAGGAAAGCAGG - Intergenic
1134938019 16:18263161-18263183 ATGGGTAGACGGAGGAAAGCAGG + Intergenic
1138211307 16:55165391-55165413 AGGTTTTGACTGAGGCAGCCTGG - Intergenic
1138865219 16:60810041-60810063 ATGTGTGAACTGTGGCAAGAGGG + Intergenic
1141123413 16:81381544-81381566 ATGTGTTGGCTGACCCAAGGCGG - Exonic
1141831531 16:86512098-86512120 TTGTGGTGACTGAGGCAGGAGGG + Intronic
1141930303 16:87197699-87197721 ATTGGTGGACTGAGGAAAGCAGG - Intronic
1144435263 17:15234220-15234242 GTGTGTTCACTCAGGCAAGTGGG + Intronic
1150924381 17:69517276-69517298 CTGTGTTGCCTGGGACAAGCAGG + Intronic
1154250621 18:12741325-12741347 ATGGGTTGAATGAGGCCCGCTGG + Intergenic
1156629848 18:38953808-38953830 CTGTGTTGATTGTGTCAAGCAGG + Intergenic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1161070101 19:2255726-2255748 ATCTGGTGCCTGAGGCCAGCGGG + Intronic
1162174870 19:8823360-8823382 AGGGGTTGACTGAGGCAGGAGGG - Intronic
1165244024 19:34487647-34487669 CTTTGTTGACTGAGGAAAGGCGG + Intronic
1165246890 19:34503073-34503095 CTGTGATGACTCAGGCCAGCTGG - Exonic
1166717420 19:44977432-44977454 ACATGTGGACTGTGGCAAGCCGG - Exonic
1167527709 19:49995267-49995289 ACTTGTTGACTGCGGAAAGCAGG + Exonic
926274762 2:11395499-11395521 ATGTGTTGTGTGGGGAAAGCTGG + Intergenic
929028914 2:37632777-37632799 ATGTGTAGATTGAGGCCAGAAGG + Intergenic
932502995 2:72200860-72200882 ATTTGTTCACTGAGGTAAGATGG - Intronic
935318341 2:101860071-101860093 ATATGTTAACTGAGGCACTCTGG - Intronic
935652760 2:105396456-105396478 ATGGGTAGACTGAGTAAAGCAGG - Intronic
939618719 2:144391522-144391544 ATGTTTTGAATGAGGTAAACTGG + Intronic
939936658 2:148301172-148301194 ATGAGTTAACTGAGTCAAGAAGG + Intronic
943569242 2:189553462-189553484 ATGTGTTGACTGTGGCTTGTAGG - Intergenic
943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG + Intergenic
946015769 2:216602841-216602863 AAGTGATGTCTGGGGCAAGCAGG - Intergenic
1169413315 20:5393317-5393339 AATTGTTAACTGAGGAAAGCAGG + Intergenic
1170387677 20:15837569-15837591 ATGTGTAGAATGCGGCAAGTTGG - Intronic
1172506080 20:35463693-35463715 ATTTGTTGACTGAGGGAGGTTGG + Intronic
1172760718 20:37319342-37319364 ATCTGTGGACTGAGTAAAGCGGG - Intergenic
1181098815 22:20524978-20525000 CTGTGTTGACTGAGACAGGAAGG + Intronic
1181510096 22:23385215-23385237 ATGAGAAGAATGAGGCAAGCAGG + Intergenic
1182549392 22:31092775-31092797 ATGGGTAAACTGAGGCAAGTTGG - Intronic
1184710670 22:46247613-46247635 ATGTGTAGCATGAGGCCAGCTGG - Intronic
949720027 3:6978211-6978233 ATGTGTAGAGGGAGGCAAGATGG + Intronic
950800037 3:15543246-15543268 AAGTGTTGAGTGTGGTAAGCTGG - Intergenic
951045604 3:18034677-18034699 TTGTCTTGACTGATTCAAGCTGG - Intronic
951690525 3:25390769-25390791 ATTTGTTGATGGAAGCAAGCAGG - Intronic
953996363 3:47522937-47522959 ATCTGGTGACTGAGCAAAGCAGG + Intergenic
954334120 3:49906254-49906276 ATGTGTTGACTGTGGAATGCAGG - Intronic
955468452 3:59261050-59261072 ATTTGTTGAGTGAGGTAATCAGG + Intergenic
955927062 3:64017457-64017479 TTGTTCTGACTGAGGGAAGCAGG + Intronic
957178635 3:76847290-76847312 ATGGGTTTAATGAGGCCAGCTGG + Intronic
960767254 3:121147723-121147745 ATCTGTAGACTGAGTGAAGCAGG + Intronic
960996767 3:123345311-123345333 CTGTGTTGGCCGAGGCAGGCTGG + Intronic
964785538 3:160391925-160391947 ATGTGGAGACTGAGGTAAACAGG + Intronic
972111334 4:35563050-35563072 ATGTAATGACTCAGGCAAGAGGG - Intergenic
976457738 4:85268198-85268220 ATCTGTAGGCTGAGGAAAGCAGG + Intergenic
980246237 4:130246325-130246347 ATGTGTTGACTGAGGTTTTCAGG + Intergenic
981239466 4:142459011-142459033 ATGAGTTGTCTGAGTCAGGCTGG - Intronic
982231328 4:153210917-153210939 ATGTGTTGAGTGTGGGAAGAGGG - Intronic
986217268 5:5731330-5731352 ATGTGTTAAGTGAAGCAAGGGGG - Intergenic
986650889 5:9962347-9962369 ATGTGTTGAGGGAGGAAAGGAGG - Intergenic
987470434 5:18321248-18321270 ATGGGATGATGGAGGCAAGCTGG + Intergenic
987524425 5:19029821-19029843 ATGTGCTGCCTGAGGTCAGCAGG - Intergenic
988785959 5:34565525-34565547 ATGTCTCAACTGAGGCAAGGGGG - Intergenic
988844459 5:35114339-35114361 AACAGTTGACTGAGGAAAGCAGG - Intronic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
990131693 5:52594466-52594488 CTGTGTTGACTGAGGTCAGTTGG - Intergenic
992001246 5:72438477-72438499 ATCTGGTGACTGAGCCAGGCAGG + Intergenic
992364545 5:76078494-76078516 TTGTGTTCACTGATACAAGCAGG + Intergenic
994100251 5:95883624-95883646 GTCAGTTGAATGAGGCAAGCAGG + Intergenic
994551654 5:101241440-101241462 ATGTTATCACTGGGGCAAGCAGG - Intergenic
995853668 5:116572806-116572828 ATGTGCAGTCTGAGGGAAGCCGG - Intronic
997365523 5:133322863-133322885 TGGGGTTGACTGAGGGAAGCTGG + Intronic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1000385248 5:160669198-160669220 ATGTGTTGACTGACTGAAGCTGG - Intronic
1006903984 6:37521032-37521054 TTCTGTTAACTGAGGAAAGCAGG - Intergenic
1007124471 6:39413774-39413796 ATGTGTTGTCTCAGGTAAGTGGG - Intronic
1007737038 6:43988141-43988163 CTGTTTTGGCTGAGGCAGGCTGG + Intergenic
1008452950 6:51674032-51674054 AGGTAGTGACTGAGGAAAGCTGG + Intronic
1013605667 6:111745306-111745328 ATGTGTTTCTTCAGGCAAGCAGG - Intronic
1016317682 6:142808410-142808432 ATGGGTGGACAGAGGCAAGGAGG + Intronic
1016629520 6:146212092-146212114 ATGTATTAACTGAGGGAATCAGG + Intronic
1022282812 7:28927941-28927963 ATGTGTTGCCGCAGGTAAGCTGG + Intergenic
1022632402 7:32097706-32097728 CAGTGTTGGCTGAGGCTAGCTGG - Intronic
1024222351 7:47298677-47298699 AGGTATTTACTGAGGCATGCCGG - Intronic
1025106817 7:56177537-56177559 ATGTTTTAGATGAGGCAAGCAGG - Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026311454 7:69188837-69188859 ATTTTTTGAATGAGGCAAGCAGG + Intergenic
1029353990 7:100037041-100037063 ATGTGTTTTCTGAGGAAAACAGG + Exonic
1030077208 7:105747123-105747145 ATGAGTTGACTGATGGCAGCGGG + Intronic
1032785831 7:135198465-135198487 AAGTGATGACTAAGGCAGGCCGG + Intronic
1035690967 8:1559377-1559399 ATTTGTTTGCTGAGGCAGGCTGG + Intronic
1035826448 8:2649185-2649207 AGGTGTGCACTGAGGCAGGCTGG - Intergenic
1037572153 8:20167453-20167475 ATGTATGGAATGGGGCAAGCAGG + Intronic
1038120564 8:24609633-24609655 ATGTCTTTACAGAGGCAATCAGG + Intergenic
1038163423 8:25061977-25061999 ATGAGTTAACTGAGGCATCCAGG + Intergenic
1039953245 8:42188401-42188423 ATGAGGAAACTGAGGCAAGCGGG + Intronic
1042175203 8:66031796-66031818 ATCAGTTGACTGAGTAAAGCAGG - Intronic
1044462182 8:92458415-92458437 ATGTGTTGAGTGATGGAGGCTGG - Intergenic
1044603176 8:94026046-94026068 AGTTGTTGAATGAGGCAAACTGG + Intergenic
1048351236 8:133618380-133618402 CTGTGTTGACTTAGGGAATCAGG + Intergenic
1049713647 8:144078992-144079014 CTGTGTAGACTGAGGCGCGCCGG - Intronic
1051390059 9:16554401-16554423 ATGTGTTGAATGAAGCCAGCGGG - Intronic
1051700456 9:19817208-19817230 ATGTGTGGAATGATCCAAGCTGG - Intergenic
1055010668 9:71561518-71561540 ATGAGGTGACTGACGGAAGCTGG - Intergenic
1056145838 9:83728662-83728684 TTGTATTGACTGAGCCTAGCAGG + Intergenic
1056533484 9:87507878-87507900 ATGTGATGAATGAGGCTGGCTGG + Intronic
1056832865 9:89930890-89930912 ATGTGTGGACTGAGAGAAGAAGG + Intergenic
1056954172 9:91069149-91069171 ATCAGTGGACTGAGGAAAGCAGG - Intergenic
1058075106 9:100643036-100643058 ATGTGTGGACTGAGGAAAAAAGG + Intergenic
1058174657 9:101723047-101723069 ATGTGTTGTGGGAGGCACGCAGG + Intronic
1058432367 9:104930149-104930171 ATTCTTTGACTGAGGCAAGGGGG - Intergenic
1060308719 9:122439930-122439952 AGGTGAGGACTGAGTCAAGCAGG + Intergenic
1185834645 X:3333893-3333915 AGGTGTTGACTACTGCAAGCTGG + Intronic
1187556955 X:20361237-20361259 ATGTGTTATCTAAGGCAAGGGGG + Intergenic
1189167775 X:38878314-38878336 ATGTGTTGAATGAAAGAAGCTGG - Intergenic
1195672770 X:107483611-107483633 ATGTGGTGGCTGAGCCAAACAGG - Intergenic
1196017981 X:110959673-110959695 ATGTGTCAATTAAGGCAAGCAGG - Intronic
1196245126 X:113391389-113391411 ATATGTCGACTGTGGCATGCTGG + Intergenic
1197151869 X:123228965-123228987 GTGTGTTGCCTGTGGCAATCAGG - Intronic