ID: 909519881

View in Genome Browser
Species Human (GRCh38)
Location 1:76555489-76555511
Sequence TGGATCAGTCAGCATTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909519881_909519886 14 Left 909519881 1:76555489-76555511 CCCAGGAAATGCTGACTGATCCA 0: 1
1: 0
2: 0
3: 21
4: 182
Right 909519886 1:76555526-76555548 GGTCATTAATGTTCTCCTAAAGG No data
909519881_909519883 -7 Left 909519881 1:76555489-76555511 CCCAGGAAATGCTGACTGATCCA 0: 1
1: 0
2: 0
3: 21
4: 182
Right 909519883 1:76555505-76555527 TGATCCAAACAAAGTGAACCTGG 0: 1
1: 0
2: 0
3: 4
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909519881 Original CRISPR TGGATCAGTCAGCATTTCCT GGG (reversed) Intronic
902571295 1:17348471-17348493 TGGATCAGTGGTCATTTCCTGGG + Intronic
903573818 1:24325488-24325510 TGGCTGAGACAGCATTTCCTTGG + Intronic
907122913 1:52023292-52023314 TGGGTCAGTCAGCTCTTCCAAGG + Intronic
907741034 1:57165972-57165994 TGAATCAGGCAGCATTTCAGTGG + Intronic
908361447 1:63372054-63372076 AGGATGAGTCAGAATTTTCTAGG + Intronic
908572482 1:65423903-65423925 TGAGTCAGTCAGCATTTATTTGG + Intronic
908896978 1:68911737-68911759 TGGGTAAGTCAGCTTCTCCTGGG - Intergenic
909188423 1:72520302-72520324 TGGAAGAGACAGCAATTCCTAGG - Intergenic
909519881 1:76555489-76555511 TGGATCAGTCAGCATTTCCTGGG - Intronic
909771867 1:79433511-79433533 TGGTTCACTCACCATTGCCTGGG + Intergenic
910688057 1:89938488-89938510 TGCATGAGTCAGCATTTCTCAGG - Intergenic
910789796 1:91039373-91039395 TAGGTCAATCATCATTTCCTTGG - Intergenic
918672928 1:187242839-187242861 GGGATCAGTCAGGTTTTCCCTGG + Intergenic
919577033 1:199323060-199323082 TGTATCAGTCAGGATGTACTGGG - Intergenic
920734826 1:208523733-208523755 TGGGTCAGTCAGAATATTCTAGG - Intergenic
923503347 1:234584578-234584600 TCGTGCAGTGAGCATTTCCTAGG + Intergenic
923950037 1:238939904-238939926 TTGACCAGTCAGCTTTTTCTTGG - Intergenic
1063338562 10:5241144-5241166 TATATTAGTCAGCAGTTCCTGGG - Intergenic
1063475289 10:6323062-6323084 TGGATCATTCATCATGACCTCGG + Intergenic
1064081276 10:12309836-12309858 TGGACCAGTCAGCAGGACCTGGG - Intergenic
1065428238 10:25627985-25628007 AGTATCAGTCAGCTTTTCCCGGG - Intergenic
1068248767 10:54408884-54408906 TGGGAAAGGCAGCATTTCCTAGG + Intronic
1068765195 10:60755543-60755565 TGGACTAGTCACCATATCCTTGG - Intergenic
1070138479 10:73717201-73717223 TGGATTATTTTGCATTTCCTTGG - Intergenic
1073717693 10:106126263-106126285 AGGATCAGTCAGTCTTTCCTTGG + Intergenic
1074064337 10:109999786-109999808 TTGAACATTCAGCATTTCCTAGG + Intronic
1075182803 10:120227092-120227114 TGGATAAGTCAGCCTATCTTTGG - Intergenic
1076235559 10:128861383-128861405 TTGTTCAGGAAGCATTTCCTGGG + Intergenic
1080584635 11:33670430-33670452 TGACTCACTCAGTATTTCCTGGG - Exonic
1082186269 11:49185657-49185679 TTGATCATTCACCATTTGCTGGG + Exonic
1083692787 11:64420580-64420602 TGTATCAGTCAGCTTTTGCTGGG + Intergenic
1084342921 11:68520136-68520158 TGGCTCAGTTGGCATTTACTAGG + Intronic
1086258712 11:84912112-84912134 TGCTTCAGTTAACATTTCCTTGG + Intronic
1086329887 11:85743503-85743525 AGAATCAGTCAGCATTTCTCAGG - Intronic
1086680062 11:89659714-89659736 TTGATCACTCACCATTTGCTGGG - Intergenic
1090876920 11:130798435-130798457 GGTATCATTCAGCATTTCCAGGG - Intergenic
1091443978 12:532968-532990 TGGGGCAGGCAGCATTTCGTGGG + Intronic
1092140065 12:6177777-6177799 TGGCTTAGTCAGCATTTGGTGGG - Intergenic
1092733097 12:11553015-11553037 TGGATGAGTTTGCATTTTCTAGG - Intergenic
1093018009 12:14173923-14173945 TGTATCAGTCAGCTTTTGCTGGG - Intergenic
1095298680 12:40556977-40556999 AGGATCAGCCAGAATTTGCTGGG + Intronic
1095416208 12:41979508-41979530 TGGATGAGGCTGCATCTCCTGGG - Intergenic
1096421571 12:51462944-51462966 GGGGTCAGTCAGGATTACCTGGG + Intronic
1097297576 12:57983942-57983964 TGGATCACTAAGAATTTCATTGG + Intergenic
1100155098 12:91789404-91789426 TGGATCTTTCATCTTTTCCTTGG - Intergenic
1101687817 12:107043331-107043353 TGGCCAAGTCACCATTTCCTGGG - Intronic
1101760638 12:107655947-107655969 TTGAGTAGCCAGCATTTCCTAGG + Intronic
1101783906 12:107864907-107864929 TGGACCAGTCAGCATTATGTGGG + Intergenic
1102015971 12:109648270-109648292 TGGATCAGCCAACAGCTCCTGGG - Intergenic
1102811770 12:115830612-115830634 TGGATCATTTGGCACTTCCTTGG - Intergenic
1104317665 12:127719204-127719226 TGCAGCAATCAGAATTTCCTGGG + Intergenic
1105513069 13:21067271-21067293 TGAATCCCTCAGAATTTCCTGGG + Intergenic
1106296691 13:28420595-28420617 TGAAAAAGTCAACATTTCCTGGG - Intronic
1111506864 13:89202052-89202074 TGGATCAGTCAGTAATACTTTGG - Intergenic
1112995622 13:105571532-105571554 TGAATCAGTTAGAATTTCCTTGG - Intergenic
1119488373 14:75008034-75008056 TGGATCATTTAGCATTGTCTGGG + Intronic
1120033383 14:79667989-79668011 TGTATCAGTCTGCATGTCCCAGG - Intronic
1120033713 14:79671424-79671446 TCTAGAAGTCAGCATTTCCTTGG + Intronic
1120922772 14:89770240-89770262 TGTATCAGTCAGCTTTCACTAGG + Intergenic
1121229231 14:92344398-92344420 TGTATCAGTCAGCTTTCACTAGG - Intronic
1121411215 14:93749475-93749497 GGAATCAGTCTGCATTTACTTGG - Intronic
1122418577 14:101561692-101561714 TGTATCCGCAAGCATTTCCTGGG + Exonic
1122710838 14:103656440-103656462 TGGCTCTGTCAGCATATCTTAGG + Intronic
1124051892 15:26204433-26204455 TGCTCCAGTGAGCATTTCCTTGG - Intergenic
1124165873 15:27325142-27325164 TGTATCAGTCAGCACATGCTAGG + Intronic
1124957699 15:34370528-34370550 TGTATCAGTCACCATTACCTGGG + Intergenic
1127583483 15:60359375-60359397 GGGATGAGTCAGCCTCTCCTAGG - Intronic
1128384788 15:67139691-67139713 TTGATCAGTTAACATTTCCCAGG - Intronic
1131311357 15:91293351-91293373 TTGATCAGACCTCATTTCCTGGG - Exonic
1132026769 15:98410511-98410533 TAGATCAGTCAGGATATGCTAGG + Intergenic
1133058677 16:3160295-3160317 TGGATCAGTCCTAGTTTCCTCGG - Intergenic
1134935355 16:18240833-18240855 TGTATTAGTCAGCATTCTCTAGG - Intergenic
1135261822 16:20987646-20987668 AAGATCATTCAGCATATCCTTGG - Intronic
1135354814 16:21760257-21760279 TGTGTCAGTCAGCATGTACTAGG - Intronic
1135453298 16:22576399-22576421 TGTGTCAGTCAGCATGTACTAGG - Intergenic
1135980852 16:27145814-27145836 TGTATCAGTCAGCATAGGCTAGG + Intergenic
1137818233 16:51419970-51419992 AGGCTGAGTCAGCATTGCCTTGG + Intergenic
1138121793 16:54406047-54406069 GGGACCACTCAGCATCTCCTAGG + Intergenic
1142525700 17:539002-539024 AGGTGCTGTCAGCATTTCCTGGG + Intronic
1143322759 17:6078845-6078867 GAGATCAGTCAGGATTTCTTGGG + Intronic
1146480156 17:33198552-33198574 TGGATCAGTCACCATGTGCAGGG - Intronic
1148114706 17:45168966-45168988 TGGATCAGACAGCCTGTCCTTGG - Intronic
1148201972 17:45755383-45755405 TGGAACAGACAGTGTTTCCTTGG + Intergenic
1149251566 17:54776411-54776433 TGGATCATTCAGCTATTCCTGGG - Intergenic
1152305167 17:79516143-79516165 TGTATCAGTCTGCATTCTCTGGG + Exonic
1152920377 17:83063565-83063587 TCGGTCCGTCAGCAGTTCCTGGG - Intergenic
1156504385 18:37579827-37579849 TAGAGCAGGCAGCATTTCCCTGG - Intergenic
1158315298 18:56205529-56205551 AGGAGAAGTCAGCATTTCCCTGG + Intergenic
1159579291 18:70217253-70217275 TGGTCCAATGAGCATTTCCTTGG - Intergenic
1160313948 18:77822843-77822865 TGGATGAATCAGCATTTCGAAGG - Intergenic
1164508374 19:28877789-28877811 TCCATCATTCAGCACTTCCTGGG - Intergenic
1164784017 19:30915134-30915156 TGGATCAGAAAGCATTTCTCAGG + Intergenic
1165999172 19:39867657-39867679 TGTATCAGTTAGCTTTTGCTGGG - Intronic
927462972 2:23315171-23315193 TGGATCAGGCAGACTTGCCTGGG + Intergenic
927735715 2:25519638-25519660 TGCACCAGTGAGCATTTCCTTGG + Intronic
932708914 2:74047827-74047849 TGGATGAGCCTGCACTTCCTGGG - Exonic
933081947 2:78001292-78001314 TTGATTAGTCAGCATTCACTAGG + Intergenic
936613125 2:114020887-114020909 TGTATCAGTCAGGATATGCTGGG - Intergenic
940840448 2:158573971-158573993 TGGGACAGCCAGCCTTTCCTTGG + Intronic
941301802 2:163811786-163811808 TGTATCAGGCAGCTTTTGCTAGG + Intergenic
943974219 2:194450191-194450213 TGCATTAGGCAACATTTCCTGGG + Intergenic
946153925 2:217794541-217794563 TGGAACAGTCAGCATTCTCTGGG - Intergenic
947999390 2:234555356-234555378 TGTATCAGTCAGGAAATCCTAGG + Intergenic
948606176 2:239137158-239137180 TGGACCAGTCGGCATCTCCAAGG - Intronic
1172329069 20:34062050-34062072 TAGATCATGCAGCATATCCTAGG + Intronic
1172450495 20:35019229-35019251 TTGCACAGTCAGCATTTCCTGGG - Intronic
1172622428 20:36328294-36328316 TTGATCACTCAGCTTCTCCTGGG + Intronic
1173218729 20:41113509-41113531 AGCATCAGTCAGCATGGCCTGGG - Intronic
1173584173 20:44169519-44169541 TGGATCTCCCAGCTTTTCCTTGG - Intronic
1173837276 20:46134308-46134330 TGGCTCAGGCAACATGTCCTGGG + Intergenic
1174079481 20:47960840-47960862 TGGATCAGGCAGAACCTCCTGGG - Intergenic
1174950367 20:55035623-55035645 TGGATCAGCCAGCAGTACCAAGG + Intergenic
1175205093 20:57305223-57305245 TGGCTCACACAGCCTTTCCTCGG - Intergenic
1179131250 21:38639083-38639105 TGGGTTGGTCAGCATCTCCTGGG - Intronic
1180945418 22:19689725-19689747 TGGATGGGTCAGCATCGCCTGGG - Intergenic
1181992575 22:26848567-26848589 AGGGTCAGTCAGCATTGACTTGG + Intergenic
1182084940 22:27555035-27555057 TCATTCACTCAGCATTTCCTGGG + Intergenic
1182961261 22:34477432-34477454 TGTATCCGTCAGTATTTGCTAGG - Intergenic
1183509881 22:38228473-38228495 TGGACCAGTCAGCAGTTCCCAGG + Intronic
949818395 3:8087555-8087577 TAGATCATCCAGCATTTTCTAGG + Intergenic
950111163 3:10419589-10419611 TGGATCACTCAGCCTCTCCGAGG + Intronic
953473543 3:43186472-43186494 TGAATCAATCAGTATGTCCTAGG - Intergenic
956508981 3:69974470-69974492 TGGACCAGTCATTATTTCCAGGG + Intergenic
957189443 3:76987765-76987787 TGGATAAATAAGCATTTCCTTGG + Intronic
960973238 3:123154076-123154098 TGGATCAGCCTGCAGCTCCTGGG + Intronic
961014493 3:123457209-123457231 GGGACCAGAGAGCATTTCCTGGG + Intergenic
962875367 3:139532076-139532098 TGGGCCAGTCACCATTTCCTGGG - Intronic
963096975 3:141553502-141553524 TGCTGCAGTGAGCATTTCCTTGG + Intronic
966667008 3:182482603-182482625 TGGATAAGTCAGCCCTGCCTTGG + Intergenic
967522086 3:190444137-190444159 TACATCACTCAGCATTTTCTAGG + Intronic
969353718 4:6613140-6613162 TGGACCAATCAGCATGGCCTGGG + Intronic
969956573 4:10897246-10897268 AGGATAGCTCAGCATTTCCTGGG + Intergenic
970641129 4:18067233-18067255 TGCATGATTCATCATTTCCTAGG + Intergenic
971080118 4:23200189-23200211 TGCATCTGTCAGGATTTCTTTGG - Intergenic
971242550 4:24901694-24901716 TGCATCATTCAGAGTTTCCTGGG - Intronic
972767438 4:42164696-42164718 TGGACCAGGCATCATTGCCTGGG + Intergenic
973266709 4:48218561-48218583 TGTATCTTTCAGCACTTCCTAGG - Intronic
973337267 4:48969404-48969426 TGGATCATTCAGCAGTTTCTTGG - Intergenic
974303980 4:60107502-60107524 TAGATCACTCACCATTTTCTTGG + Intergenic
974411286 4:61544076-61544098 TGGATCAGTGTGAGTTTCCTTGG + Intronic
974893640 4:67912159-67912181 TGGAGCATTCAGCATTTACCAGG - Intronic
977672168 4:99708162-99708184 TGCTTCAGTGAGTATTTCCTTGG + Intergenic
981048605 4:140289592-140289614 TGGAACAGTCAGCAGTTCACAGG - Intronic
981286015 4:143020045-143020067 TGGCTAAGGCACCATTTCCTTGG + Intergenic
983040567 4:162920680-162920702 TGGAACTGTCTACATTTCCTTGG - Intergenic
983050108 4:163036484-163036506 TAGATTTTTCAGCATTTCCTTGG - Intergenic
986670296 5:10137614-10137636 TGGTTCAGTCACAATTTCCAGGG + Intergenic
987944365 5:24585324-24585346 AAGATCAGTCATCAATTCCTTGG + Intronic
988356310 5:30180208-30180230 TGGATGAGTCAACATATTCTGGG - Intergenic
990021390 5:51131478-51131500 TGTATCTGTCATCATTTCTTTGG + Intergenic
990764965 5:59171721-59171743 TTTATCAGGGAGCATTTCCTAGG + Intronic
992846684 5:80756554-80756576 AGGATCAGGGAGGATTTCCTGGG - Intronic
993683940 5:90915153-90915175 TGGATAAGTGAGCATTTTCTAGG - Intronic
996498153 5:124185852-124185874 CTGATCATTCAGCATCTCCTTGG - Intergenic
998998550 5:147894055-147894077 TTGCTCAGTCAGAACTTCCTAGG - Intronic
999434098 5:151549681-151549703 TGGATCAGTCAATGATTCCTAGG + Intronic
1004003099 6:11613873-11613895 TGGATGGTTCAGGATTTCCTGGG - Intergenic
1007663471 6:43500739-43500761 TGCATCAGTCAGGGGTTCCTAGG - Exonic
1007691312 6:43703188-43703210 GGGATCAGTTAGCCTGTCCTGGG + Intergenic
1011047820 6:83106339-83106361 TAGAGCAGTCAGCATTTAGTTGG + Intronic
1011777828 6:90751645-90751667 TGAATCAGACAGAATATCCTGGG + Intergenic
1011787468 6:90862936-90862958 TGGGTCAGGAAGCATTTCCTTGG + Intergenic
1011911178 6:92441416-92441438 TGCATCAGTAAGCTTTTGCTAGG + Intergenic
1016774656 6:147892063-147892085 TGGATCAGTCAGGCTCTCCTGGG + Intergenic
1018972159 6:168537086-168537108 TGGACCAGTCAGGGTCTCCTTGG - Intronic
1019144272 6:169966825-169966847 AGGAGAAGGCAGCATTTCCTGGG - Intergenic
1021579922 7:22141754-22141776 TGGCTCTGCCAGCAGTTCCTTGG + Intronic
1023351530 7:39324580-39324602 TGGATCAGTCAGGATAGGCTAGG - Intronic
1023887244 7:44368009-44368031 AGGACCAGGCACCATTTCCTGGG - Intergenic
1024570419 7:50718391-50718413 AGGATCAGTAAGCAGTTCATAGG - Intronic
1025794762 7:64729329-64729351 TGTCTCAGCCAGGATTTCCTTGG + Intergenic
1031013536 7:116548481-116548503 TGGATCACACACCCTTTCCTTGG + Intronic
1033370075 7:140699238-140699260 TGGAACAGCCATTATTTCCTTGG + Intronic
1034244348 7:149633403-149633425 GGGATCAGTGAGAGTTTCCTGGG - Intergenic
1034902165 7:154914454-154914476 TGGGTCACTCCGCAATTCCTAGG - Intergenic
1035077618 7:156191363-156191385 TGGGACACTCAGCATGTCCTTGG + Intergenic
1036741058 8:11362017-11362039 GGGAACACTCAGCACTTCCTGGG + Intergenic
1037759488 8:21732541-21732563 TGGATCCTTCAGCATCTGCTGGG - Intronic
1039622821 8:39014854-39014876 GGCCTAAGTCAGCATTTCCTTGG - Intronic
1039726388 8:40221287-40221309 TGGATCTTTCTGTATTTCCTTGG + Intergenic
1040041630 8:42921681-42921703 TGGATCATTGAGGTTTTCCTGGG + Intronic
1040463238 8:47670146-47670168 AGGACCAGGCTGCATTTCCTAGG - Intronic
1045429962 8:102104586-102104608 TGGTCCAGTCTGCTTTTCCTGGG + Intronic
1047354699 8:124109277-124109299 TGGAGCAACCAGCCTTTCCTGGG - Intronic
1047440210 8:124871050-124871072 TGAATCAGTCACTATTTCCAAGG - Intergenic
1049829680 8:144692414-144692436 TGGTCCAGTCAGCATGGCCTGGG + Intergenic
1050768500 9:9166522-9166544 TGGATTCATAAGCATTTCCTTGG - Intronic
1053108287 9:35432975-35432997 TGGTTCAGCAAGCATTTGCTGGG - Intergenic
1055725626 9:79225243-79225265 TGGATCAGTAATGAATTCCTAGG - Intergenic
1056686454 9:88767166-88767188 TGGATCAGTCATCTTTTTCTTGG - Intergenic
1058702177 9:107610324-107610346 TGTATTAGTCAGGGTTTCCTAGG + Intergenic
1058915753 9:109562982-109563004 TAGATAAGTTAGCATTTTCTTGG + Intergenic
1058976286 9:110127988-110128010 TGGATCCATAAGCATATCCTGGG - Intronic
1059986636 9:119826384-119826406 AGGTTCAGTCAACATTTCTTGGG + Intergenic
1060802762 9:126555027-126555049 TGTATCAGTCAGCTATTGCTGGG - Intergenic
1062252040 9:135603141-135603163 TGGGACAATCAGCATTTCCAGGG - Intergenic
1187123230 X:16429382-16429404 TGTATCAGTTAGCTTTTGCTGGG + Intergenic
1187570597 X:20496782-20496804 TGTATCAGTTAGGATTTCATTGG + Intergenic
1189576793 X:42362407-42362429 TGGATGAGTCAGCATATTTTTGG + Intergenic
1194459858 X:94152846-94152868 TTGATCAGCAAGCATTTCCCAGG - Intergenic
1195548078 X:106136151-106136173 TGAAACAGTCACCATATCCTGGG + Intergenic
1196026110 X:111042889-111042911 TGAATCAGTCATGATTTCTTTGG + Intronic
1196521463 X:116678489-116678511 TGTATTAATCAGCATTTCCCAGG + Intergenic
1196949902 X:120866963-120866985 TGGAACAGTCTCCATATCCTTGG + Intergenic