ID: 909519882

View in Genome Browser
Species Human (GRCh38)
Location 1:76555490-76555512
Sequence TTGGATCAGTCAGCATTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909519882_909519883 -8 Left 909519882 1:76555490-76555512 CCAGGAAATGCTGACTGATCCAA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 909519883 1:76555505-76555527 TGATCCAAACAAAGTGAACCTGG 0: 1
1: 0
2: 0
3: 4
4: 123
909519882_909519886 13 Left 909519882 1:76555490-76555512 CCAGGAAATGCTGACTGATCCAA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 909519886 1:76555526-76555548 GGTCATTAATGTTCTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909519882 Original CRISPR TTGGATCAGTCAGCATTTCC TGG (reversed) Intronic
902571294 1:17348470-17348492 GTGGATCAGTGGTCATTTCCTGG + Intronic
902906239 1:19559807-19559829 TGGAATGAGTCAGGATTTCCAGG + Intergenic
904230692 1:29068351-29068373 TTGAATTAGTCTCCATTTCCAGG + Intronic
905521717 1:38605507-38605529 TGGGGTCATTCAGCATTTCACGG + Intergenic
906189831 1:43891004-43891026 ATGGGTTAGTCATCATTTCCAGG - Intronic
906626772 1:47332098-47332120 TTAGCTCACTCAGCATTTTCTGG - Intergenic
907985576 1:59526573-59526595 ATGGATCAGCCAGCTCTTCCAGG + Intronic
908896979 1:68911738-68911760 TTGGGTAAGTCAGCTTCTCCTGG - Intergenic
909519882 1:76555490-76555512 TTGGATCAGTCAGCATTTCCTGG - Intronic
909771866 1:79433510-79433532 TTGGTTCACTCACCATTGCCTGG + Intergenic
915125129 1:153658634-153658656 TTGGTGGAGACAGCATTTCCCGG + Exonic
917478952 1:175393937-175393959 TTGGGACAGACAGCATTGCCTGG + Intronic
919686353 1:200487170-200487192 TTGAATAAGTGAGTATTTCCAGG - Intergenic
920735814 1:208532325-208532347 TTGGACAAGTCATCATTTCTTGG - Intergenic
923744033 1:236684512-236684534 TTAGCTCAGTCACTATTTCCAGG + Intergenic
924222236 1:241889594-241889616 TTGCAGCAGTCTGCATTTACTGG - Exonic
924440564 1:244082190-244082212 TTAGATAAGTCACCTTTTCCAGG - Intergenic
1065428239 10:25627986-25628008 CAGTATCAGTCAGCTTTTCCCGG - Intergenic
1071503248 10:86218268-86218290 TTGGAGCAGTCAGCCCTACCAGG - Intronic
1075015372 10:118906919-118906941 TTGGGTTACTCAGCAATTCCAGG + Intergenic
1078379053 11:10823108-10823130 TGGGATCAGACACTATTTCCAGG + Intronic
1080584636 11:33670431-33670453 TTGACTCACTCAGTATTTCCTGG - Exonic
1083692786 11:64420579-64420601 CTGTATCAGTCAGCTTTTGCTGG + Intergenic
1086075195 11:82843222-82843244 TTGCTTCAGTCAGGAGTTCCAGG + Intronic
1086499522 11:87437640-87437662 CTGGGTCAGTGAGCATTTCATGG + Intergenic
1090876921 11:130798436-130798458 AGGTATCATTCAGCATTTCCAGG - Intergenic
1093018010 12:14173924-14173946 ATGTATCAGTCAGCTTTTGCTGG - Intergenic
1093022278 12:14214914-14214936 TGGGATCAGTTTACATTTCCAGG + Intergenic
1095416209 12:41979509-41979531 TTGGATGAGGCTGCATCTCCTGG - Intergenic
1096421570 12:51462943-51462965 TGGGGTCAGTCAGGATTACCTGG + Intronic
1100080805 12:90847622-90847644 ATGGATCAGTCAGCATGGACAGG - Intergenic
1106081221 13:26501564-26501586 TGGGAGCAATGAGCATTTCCAGG + Intergenic
1106296692 13:28420596-28420618 TTGAAAAAGTCAACATTTCCTGG - Intronic
1107878536 13:44812672-44812694 TTGGAGCCATCAGCATTTCTAGG - Intergenic
1108746235 13:53397411-53397433 TTGGATCTGACAGCATATCAAGG + Intergenic
1111268032 13:85844797-85844819 TCTGATCAGGCAGCATTTCCTGG + Intergenic
1115248251 14:31318817-31318839 TTGGAGCTGACAGCATTGCCTGG + Intronic
1115967752 14:38911605-38911627 TTGGATGACTTAGCAGTTCCAGG + Intergenic
1119488372 14:75008033-75008055 TTGGATCATTTAGCATTGTCTGG + Intronic
1122302193 14:100737572-100737594 TCTGATCAGGAAGCATTTCCAGG + Exonic
1124957698 15:34370527-34370549 CTGTATCAGTCACCATTACCTGG + Intergenic
1126999101 15:54481515-54481537 TTGGATCAGTCCCCAGGTCCAGG + Intronic
1127604872 15:60576326-60576348 TTGGCACATTCTGCATTTCCAGG - Intronic
1129808218 15:78482272-78482294 TTGGATCAGTCAGAATAAACAGG + Intronic
1131311358 15:91293352-91293374 TTTGATCAGACCTCATTTCCTGG - Exonic
1131806555 15:96128042-96128064 CTGGATCAATCAACATTGCCTGG - Intergenic
1133139831 16:3735611-3735633 TTGGCTCAGTCTGCACTGCCTGG + Intronic
1135815376 16:25627827-25627849 TTTGATGAGTCAGCTTTTCAAGG - Intergenic
1140536692 16:75716273-75716295 TGGGATCTGACAGTATTTCCAGG - Intronic
1146480157 17:33198553-33198575 CTGGATCAGTCACCATGTGCAGG - Intronic
1148131351 17:45264303-45264325 TTGGATCAGTGACCATTTGCTGG - Exonic
1149251567 17:54776412-54776434 CTGGATCATTCAGCTATTCCTGG - Intergenic
1149335245 17:55628636-55628658 TTTGATCAATCAGAAATTCCTGG + Intergenic
1152143641 17:78553904-78553926 GTGGATCACTGAGCATTTCTTGG + Intronic
1152920378 17:83063566-83063588 TTCGGTCCGTCAGCAGTTCCTGG - Intergenic
1153341086 18:3975748-3975770 TAGGATGTGTCAGAATTTCCTGG - Intronic
1157306813 18:46523514-46523536 TTGTTTAAGTCACCATTTCCAGG + Intronic
1158203889 18:54969629-54969651 TTTGGTCAGTCAGCATGCCCAGG - Intergenic
1159778177 18:72628285-72628307 TTGCAACAGTCAGGTTTTCCAGG + Intronic
1164508375 19:28877790-28877812 TTCCATCATTCAGCACTTCCTGG - Intergenic
1164730754 19:30502433-30502455 TCCGATCACTCACCATTTCCAGG - Intronic
1166536253 19:43576742-43576764 TTGGAGCACCCAGCATGTCCAGG - Intronic
929966459 2:46541111-46541133 TTTGTTCAGGCAGCATTTGCAGG - Intronic
931195911 2:60052250-60052272 CTTCATCAGGCAGCATTTCCAGG - Intergenic
931597346 2:63963060-63963082 TTGGATTATTCAGCATTTTGAGG - Intronic
932813476 2:74843490-74843512 ATGGATCTCTAAGCATTTCCCGG + Intronic
936758481 2:115744196-115744218 TAGCATCAATCAGCATCTCCTGG - Intronic
937490532 2:122362672-122362694 CTGGGTCAGTCAGATTTTCCTGG + Intergenic
940899225 2:159110985-159111007 TTGGATTATTCATCTTTTCCTGG + Intronic
942892760 2:181012113-181012135 TATGATCAGTCAGCAACTCCAGG + Intronic
943029429 2:182668757-182668779 CTGGAGCACTCACCATTTCCTGG + Intergenic
943513523 2:188856185-188856207 AAGGATCACTCACCATTTCCTGG - Intergenic
946153926 2:217794542-217794564 CTGGAACAGTCAGCATTCTCTGG - Intergenic
946407853 2:219501644-219501666 TGGGTTGAGTCAGCATTTGCTGG + Intronic
946837266 2:223784555-223784577 TTGGGTTATTCAGCATTTGCAGG - Intronic
947168026 2:227282412-227282434 TTGGATAGATCAGGATTTCCTGG + Exonic
947724698 2:232389498-232389520 TTGGATGAATCAGCGTGTCCTGG + Intergenic
948392333 2:237621442-237621464 TTGGCTCCTTCTGCATTTCCTGG + Intergenic
948713471 2:239840708-239840730 TTGGATCACTCATCTTTGCCTGG + Intergenic
1170584580 20:17724881-17724903 TTCCATCATCCAGCATTTCCCGG - Intronic
1172450496 20:35019230-35019252 TTTGCACAGTCAGCATTTCCTGG - Intronic
1172622427 20:36328293-36328315 TTTGATCACTCAGCTTCTCCTGG + Intronic
1172788495 20:37486270-37486292 TTGGAGCAGGCAGCAGGTCCAGG + Intergenic
1175857258 20:62128676-62128698 TTGTCTCACTCAGCATGTCCGGG - Intronic
1178365188 21:31984490-31984512 TGGGATCAGGCAGGCTTTCCTGG + Intronic
1178521795 21:33292960-33292982 TTGGAACAGTCAGTATTCCTAGG + Intronic
1179131251 21:38639084-38639106 TTGGGTTGGTCAGCATCTCCTGG - Intronic
1179328113 21:40370478-40370500 TTATTTCAGTCAGAATTTCCAGG + Intronic
1182084939 22:27555034-27555056 TTCATTCACTCAGCATTTCCTGG + Intergenic
1182628024 22:31662478-31662500 TTGGATGACTCAGATTTTCCAGG - Intergenic
1184023210 22:41834410-41834432 TTAGATAAGTCAACATCTCCTGG - Intronic
951924222 3:27889170-27889192 TTGAATGAATCAGCATCTCCAGG - Intergenic
953160158 3:40411773-40411795 CAGCATCTGTCAGCATTTCCAGG - Intronic
953380064 3:42463286-42463308 TTGGATCAGTAACCAAGTCCTGG - Intergenic
955311933 3:57897125-57897147 TTGGATCAGTCAAGATTACGAGG + Intronic
955512660 3:59696980-59697002 TTGGTACAGTCAGCATTTTCAGG + Intergenic
956508980 3:69974469-69974491 CTGGACCAGTCATTATTTCCAGG + Intergenic
960285956 3:115828904-115828926 CTGCACCAGTCAGCCTTTCCTGG - Intronic
961014492 3:123457208-123457230 TGGGACCAGAGAGCATTTCCTGG + Intergenic
962704721 3:138032040-138032062 TAGGATCAGTGAGCTTTTCATGG - Exonic
962875368 3:139532077-139532099 CTGGGCCAGTCACCATTTCCTGG - Intronic
968271738 3:197408324-197408346 TTGGAGCAGTCAGCTCTTTCTGG + Intergenic
969592714 4:8130976-8130998 TTGGGGCAGCCTGCATTTCCTGG + Intronic
970142477 4:12997178-12997200 TTGGGTCAGACAGCAATTCAGGG - Intergenic
972605328 4:40608384-40608406 TTATATCAGTGAGCATTTACTGG - Intronic
972767437 4:42164695-42164717 TTGGACCAGGCATCATTGCCTGG + Intergenic
973108298 4:46368212-46368234 TTGGATTAGTCAGAATTAACTGG - Intronic
973729550 4:53810515-53810537 TTGATTCAGTCACCATTTCTTGG - Intronic
974087572 4:57277552-57277574 TTGGCTCAATAAGCATTTGCAGG - Intergenic
975818447 4:78244334-78244356 GTGGATAAGTCATGATTTCCTGG + Intronic
976956078 4:90902236-90902258 TTGGATCACACTGAATTTCCTGG + Intronic
977243283 4:94600025-94600047 TTGGGTCATCCAGCATCTCCTGG - Intronic
977270744 4:94914998-94915020 TTTGATCATTCAGAATTTGCAGG + Intronic
977387122 4:96355800-96355822 TAGGATCTGAGAGCATTTCCTGG - Intergenic
983768590 4:171519245-171519267 TGGGATCTGACAGTATTTCCAGG - Intergenic
986670295 5:10137613-10137635 CTGGTTCAGTCACAATTTCCAGG + Intergenic
987594280 5:19975841-19975863 TTGGAAGAGTCAGCACATCCAGG + Intronic
988088596 5:26504802-26504824 CTGTAACAGTTAGCATTTCCAGG + Intergenic
988492170 5:31714173-31714195 TTGGCTCAGTAAGTTTTTCCAGG + Intronic
992846685 5:80756555-80756577 TAGGATCAGGGAGGATTTCCTGG - Intronic
994333620 5:98538044-98538066 TCGGATCCCTCAGCCTTTCCTGG - Intergenic
995606268 5:113859365-113859387 TAGGATCAGTCACTAGTTCCTGG + Intergenic
997587462 5:135051926-135051948 TTGGCTCAGTCAGGGCTTCCAGG + Intronic
997634150 5:135392181-135392203 ATGGAGCAGTGAGCAATTCCAGG - Intronic
1004003100 6:11613874-11613896 TTGGATGGTTCAGGATTTCCTGG - Intergenic
1004739792 6:18447674-18447696 GTGGAACTGTCAGGATTTCCTGG + Intronic
1005089158 6:22038335-22038357 TCTGCTCTGTCAGCATTTCCAGG + Intergenic
1008378187 6:50814901-50814923 TTGGATCATTGAGTATGTCCAGG - Intergenic
1011194114 6:84764564-84764586 CTTGATCTGTCAGCACTTCCAGG + Intergenic
1011727975 6:90230025-90230047 CTGGATCAGTCAGAATGTCGGGG - Intronic
1012428469 6:99140833-99140855 TTGGATCAGTGATCTTTTCTGGG - Intergenic
1014302422 6:119699337-119699359 TTAGATCAGCCAGAATCTCCGGG + Intergenic
1014488708 6:122035376-122035398 TTGCTGCAGTCAGCATTTCTAGG - Intergenic
1016774655 6:147892062-147892084 CTGGATCAGTCAGGCTCTCCTGG + Intergenic
1018587352 6:165376294-165376316 TTGCATCAGTCATCATTTTCAGG - Intronic
1019881143 7:3862340-3862362 CTGGTTCAGACAGCATTTCCAGG + Intronic
1020493140 7:8814235-8814257 TTGGATGAGTCAGGAGTGCCAGG - Intergenic
1021134496 7:16948852-16948874 TTGCATCAATCAGCATGACCTGG + Intergenic
1022956298 7:35384752-35384774 TTGTATCCGACAGCATTACCAGG - Intergenic
1024278939 7:47702339-47702361 TTGGATCAGGCCTTATTTCCTGG + Intronic
1031556560 7:123183689-123183711 CTGAATCAATCAGCATTTTCAGG + Intronic
1034783935 7:153907869-153907891 GTGTATCAGTCAGCGTTCCCAGG - Intronic
1034865670 7:154639576-154639598 CTGCATCAGTCAGCATTTGGAGG + Intronic
1036198181 8:6741344-6741366 TTGTATGAGTCAGCGTTTCATGG + Intronic
1036741057 8:11362016-11362038 TGGGAACACTCAGCACTTCCTGG + Intergenic
1039478020 8:37851423-37851445 TTGGGTCAGGCAGGATTTCAAGG - Intergenic
1040041629 8:42921680-42921702 TTGGATCATTGAGGTTTTCCTGG + Intronic
1040945244 8:52877211-52877233 TTGCAACAGACAGCATTTGCAGG + Intergenic
1041563307 8:59246039-59246061 TTGGATCAGTCAGATTTTGCTGG + Intergenic
1042493068 8:69423965-69423987 TAGAATCAATCAGCACTTCCAGG - Intergenic
1043697923 8:83244569-83244591 TTGCATCTGTCAACTTTTCCAGG - Intergenic
1045685473 8:104706855-104706877 TTAGCTAAGTCAGAATTTCCAGG + Intronic
1047783703 8:128133189-128133211 TTGGAGCAGGCAGCATTTGTGGG - Intergenic
1052477215 9:28974917-28974939 TTGGACAAGTCAGAATTTCTTGG + Intergenic
1052736569 9:32348432-32348454 TTGGATCATTCATCATTTTCCGG - Intergenic
1053108288 9:35432976-35432998 TTGGTTCAGCAAGCATTTGCTGG - Intergenic
1054993514 9:71357526-71357548 TTGCATCTATCAGCATTTTCTGG + Intronic
1055204475 9:73711568-73711590 TTTGATCATTCAGGATTTCAGGG - Intergenic
1055358315 9:75460973-75460995 TTGCTTCTGTCAGCATTTCGTGG + Intergenic
1058976287 9:110127989-110128011 TTGGATCCATAAGCATATCCTGG - Intronic
1059161275 9:112037596-112037618 TTCTTTCAGTCATCATTTCCAGG - Intergenic
1062252041 9:135603142-135603164 ATGGGACAATCAGCATTTCCAGG - Intergenic
1062327393 9:136018688-136018710 AGGGGTCAGGCAGCATTTCCCGG + Intronic
1187123229 X:16429381-16429403 TTGTATCAGTTAGCTTTTGCTGG + Intergenic
1194121590 X:89970518-89970540 TTAGAAGTGTCAGCATTTCCAGG - Intergenic
1195862003 X:109393080-109393102 TTTGATGAGTAAGCATTTTCTGG - Intronic
1197721591 X:129748462-129748484 TTGGCTCATTCAGAATTCCCAGG - Intronic
1199440089 X:147857922-147857944 TTGGATCTATCAGCTTTTGCTGG - Intergenic
1200425036 Y:3010615-3010637 TTGGATCACACAGCTTTTCCTGG + Intergenic
1200474445 Y:3627969-3627991 TTAGAAGTGTCAGCATTTCCAGG - Intergenic