ID: 909519884

View in Genome Browser
Species Human (GRCh38)
Location 1:76555509-76555531
Sequence ATGACCAGGTTCACTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909519884_909519886 -6 Left 909519884 1:76555509-76555531 CCAAACAAAGTGAACCTGGTCAT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 909519886 1:76555526-76555548 GGTCATTAATGTTCTCCTAAAGG No data
909519884_909519888 17 Left 909519884 1:76555509-76555531 CCAAACAAAGTGAACCTGGTCAT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 909519888 1:76555549-76555571 TGAGATTTGAGATTCAAAGAAGG 0: 1
1: 1
2: 2
3: 29
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909519884 Original CRISPR ATGACCAGGTTCACTTTGTT TGG (reversed) Intronic
900538772 1:3192384-3192406 ATGACCAGGCTCAGGGTGTTAGG + Intronic
901862683 1:12084957-12084979 ATGACCAGGGTCACACAGTTGGG + Intronic
906198322 1:43943704-43943726 ATGATCAGGTTCTCTGGGTTCGG - Intergenic
907104593 1:51870994-51871016 ATGATGAGGTACACATTGTTTGG - Intronic
908320372 1:62972659-62972681 AGGGCCAGGGTCACTCTGTTGGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
911283102 1:95955875-95955897 ATGACCATGTCTCCTTTGTTCGG + Intergenic
914885213 1:151578949-151578971 ATTACCAGGTTCAGGTTATTAGG + Intronic
921181440 1:212634913-212634935 CTGGCCAGGTTTACTTTCTTAGG - Intergenic
922213675 1:223503924-223503946 ATTACCAGCATCACTTTGTGGGG - Intergenic
923682007 1:236125996-236126018 TTTACCATGTTCACTTTGTGGGG - Intergenic
924812686 1:247416980-247417002 ATGAACAAGTTGGCTTTGTTTGG - Intronic
1063228252 10:4036448-4036470 CTGATGAAGTTCACTTTGTTTGG - Intergenic
1067561197 10:47305776-47305798 GTGACCAGGTCCACTTTGCTGGG - Intronic
1069068539 10:63971767-63971789 ATTACCAGTTTTATTTTGTTTGG - Intergenic
1074573579 10:114647537-114647559 ATGACCTGGATCATTTTGTAAGG - Intronic
1075171475 10:120119758-120119780 AGGACAAGGTTCTCTTTATTTGG - Intergenic
1079947195 11:26758941-26758963 ATGACCAGGGTGACCATGTTTGG + Intergenic
1083318761 11:61832495-61832517 ATGCCCAGGTTGCCTTTGTAGGG + Intronic
1083683530 11:64362077-64362099 CTGGCCAGTTTCACTTTATTTGG + Intronic
1084699015 11:70774183-70774205 ATGACCAGCTTCTTTTAGTTAGG - Intronic
1085565726 11:77511959-77511981 ATGTCCAGTCTCACTTTGGTAGG + Intergenic
1088758834 11:112910274-112910296 ATGAACAGGTCAAATTTGTTAGG + Intergenic
1090527306 11:127551320-127551342 ATGACTAGGTTTTATTTGTTGGG + Intergenic
1095921481 12:47535794-47535816 ATGACCATGTTGTCTTTTTTTGG - Intergenic
1098031712 12:66261498-66261520 TTGACCAGGTTCACGTAGATAGG + Intergenic
1099280939 12:80645235-80645257 ATTAACAGGTGTACTTTGTTAGG - Intronic
1100572303 12:95854282-95854304 AATACCAGGTTTCCTTTGTTGGG + Intergenic
1101039686 12:100742141-100742163 ATGTCCAGGCTTACTTTGTTAGG - Intronic
1101450108 12:104768277-104768299 ATGATCAGGTCCACTGTGTCTGG + Intergenic
1106832565 13:33601381-33601403 ACGATCAGGTTCACCTTGTAAGG - Intergenic
1113480604 13:110617321-110617343 AAGAACAGGTTAAATTTGTTTGG - Intronic
1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG + Intergenic
1119164169 14:72478668-72478690 ATGCCCAGATTCACTTTATAGGG + Intronic
1120783865 14:88512280-88512302 ATGAAGATGTTCATTTTGTTGGG - Intronic
1121091577 14:91186666-91186688 ATGCCCATGATGACTTTGTTAGG + Intronic
1125174082 15:36800253-36800275 ATAACTAGGTTCTCTTTCTTTGG + Intronic
1128636326 15:69304782-69304804 ATGGTCAGGTTCACCTTGGTGGG + Intronic
1129814402 15:78539495-78539517 ATGATCAGGTTCACACTTTTGGG - Intergenic
1131149682 15:90039389-90039411 ATGCCCAGGTCCACTATCTTAGG + Intronic
1131797651 15:96035964-96035986 ATGACCAAGATCAAGTTGTTTGG + Intergenic
1132922337 16:2404006-2404028 ATGGCAAAGTTCATTTTGTTTGG - Intergenic
1141883527 16:86875608-86875630 ATGACCACGATCCCTCTGTTTGG - Intergenic
1142854448 17:2722089-2722111 GTGAACAGGGTGACTTTGTTAGG - Intergenic
1147312463 17:39603647-39603669 ATGTCCAGGGTCCCTCTGTTTGG + Intronic
1153113221 18:1619549-1619571 ATGACCATATTCATTTTGGTGGG + Intergenic
1157244187 18:46039096-46039118 ATGAACAGGTTCTATTTGTAAGG - Intronic
1158258081 18:55575969-55575991 ATGACCAGTGTCACATTGTTTGG - Intronic
925619235 2:5774660-5774682 AAGAGCAGTTTCACTTTCTTTGG - Intergenic
931175510 2:59850585-59850607 ATGGCCAGGCTTACCTTGTTAGG + Intergenic
931920190 2:67006812-67006834 ATGCCCATATTCACTCTGTTCGG + Intergenic
935044763 2:99470801-99470823 ATGACCCGGTCTCCTTTGTTCGG + Intronic
935264856 2:101385553-101385575 ACAACAAGGTGCACTTTGTTAGG - Intronic
940245936 2:151616145-151616167 ATGAACAGCTTCACTTTTTATGG - Intronic
943637955 2:190326829-190326851 ATGACCCAGGTCTCTTTGTTTGG - Intronic
945310409 2:208305710-208305732 ATGATGAGGTTTACTTTATTGGG + Intronic
948325780 2:237119623-237119645 ATGTCCAGGATAATTTTGTTAGG - Intergenic
948606643 2:239139919-239139941 ATGGCCATGTTCTTTTTGTTGGG - Intronic
1169332727 20:4729527-4729549 ATGACCAGTTTCAGTTTTTCTGG + Intergenic
1170927942 20:20742818-20742840 AAGACCTGGTTGACTTGGTTGGG + Intergenic
1174634110 20:51984118-51984140 AAGAACAGTTTCACTTTTTTAGG + Intergenic
1175139028 20:56846107-56846129 TTGCCCACGTTCACTTAGTTCGG + Intergenic
1175481657 20:59315482-59315504 ATGAACATGTTCTATTTGTTGGG + Intronic
1184485687 22:44777517-44777539 CTGAGCAGGGTCACTCTGTTGGG + Intronic
953614714 3:44479194-44479216 TTGAGCAGGTTCTCTGTGTTTGG + Intergenic
955868288 3:63409027-63409049 AGGACAAGGTTCACCTGGTTTGG - Intronic
957554080 3:81743700-81743722 AAGACCAGATTTACTTTGTCTGG + Intronic
966167823 3:177041040-177041062 TTGACTATGTTTACTTTGTTGGG - Intronic
969708134 4:8824273-8824295 ATGACCAGGTTCTCATTAATAGG - Intergenic
974891857 4:67893029-67893051 ATAACCAGCTTAACTTTGATAGG - Intergenic
977390656 4:96405566-96405588 TTGCCCAGGGTCACATTGTTGGG + Intergenic
978865504 4:113504797-113504819 ATGACCAAGTTCATTTCTTTTGG - Intronic
981138878 4:141244140-141244162 ATTACTAAGTTTACTTTGTTAGG - Intergenic
983206503 4:164915936-164915958 ATCACCAGCATCACTGTGTTTGG + Intergenic
983212120 4:164969610-164969632 ATCACCAGCATCACTGTGTTTGG - Exonic
986096500 5:4559673-4559695 ATGAACAGGCTTAGTTTGTTGGG + Intergenic
988947944 5:36225373-36225395 TTGACCATGTTCACATTCTTGGG - Intronic
992553053 5:77877344-77877366 AAAACCAAGTTGACTTTGTTTGG - Intergenic
993356905 5:86924617-86924639 ATGACAATGTTAAGTTTGTTTGG - Intergenic
996312428 5:122121932-122121954 AAGACCAGGTTCACCTGGCTGGG + Intergenic
998771614 5:145552135-145552157 AGGACCAGGTTGTCTTTCTTGGG + Intronic
999495951 5:152097138-152097160 ATCACCAGATTCACTTGGCTTGG + Intergenic
1000592715 5:163177795-163177817 AGGACAAAGTTCATTTTGTTTGG + Intergenic
1001043993 5:168357084-168357106 ATCACAAGTTTCTCTTTGTTGGG + Intronic
1003645156 6:7908952-7908974 ATTAACAGTTTCTCTTTGTTCGG - Intronic
1003892056 6:10572333-10572355 CAGTCCAGGTTCACTTTGGTTGG - Intronic
1004615739 6:17287170-17287192 ATGACCAGGTGTGATTTGTTAGG - Intronic
1007939237 6:45761885-45761907 ATGACCAGTATCTTTTTGTTTGG - Intergenic
1013492023 6:110657145-110657167 TTGACCAAGTTCACTCTGTGCGG + Intronic
1016405464 6:143724975-143724997 ATGAACAAGTTCACTTTCTATGG + Intronic
1021376818 7:19918669-19918691 ATAACCAGGTTAACTATGATGGG + Intergenic
1028002254 7:85513998-85514020 CTCACCAGGTTTTCTTTGTTAGG - Intergenic
1028719722 7:94014788-94014810 ATCAGCAGGTTCACATTGTATGG - Intergenic
1029338343 7:99921403-99921425 ATCAGCTGGTTCACCTTGTTGGG - Intergenic
1032472197 7:132186544-132186566 AAGAGCACGTCCACTTTGTTAGG + Intronic
1034608641 7:152343613-152343635 GTGACCAGGTGTAGTTTGTTTGG - Intronic
1039609102 8:38904841-38904863 ATGACCATGTACTCCTTGTTAGG + Intronic
1039819438 8:41123073-41123095 TTGAACAGGTTCAGTTTGATAGG - Intergenic
1039926385 8:41936451-41936473 ATGAGCATTTTTACTTTGTTGGG - Intronic
1041926783 8:63245177-63245199 ATGACTAGTTTAACTTTGATTGG + Intergenic
1045443171 8:102235516-102235538 ATGACCTAGTTGACTTTGTGAGG - Intronic
1046373760 8:113348382-113348404 ATCACCAGGTTGTCTTTGTTTGG - Intronic
1049461765 8:142733019-142733041 ATGACCCTGTTTCCTTTGTTGGG - Intronic
1050836209 9:10082098-10082120 ATGAAGAGGTTCATTTTGTATGG - Intronic
1051835658 9:21335111-21335133 ATGACCTGGTTCACCTCGTCCGG + Exonic
1052118967 9:24685146-24685168 ATGACCATGTTCACTGTCTATGG + Intergenic
1052751873 9:32499910-32499932 ATGTCCAGCTTGAGTTTGTTCGG + Intronic
1186020952 X:5254596-5254618 ATGAAGAGCTTCAATTTGTTTGG + Intergenic
1190497870 X:51044080-51044102 ATGGCCATTTTCACTTTGATGGG + Intergenic
1195930197 X:110066724-110066746 AGGACAAGGTTCTTTTTGTTTGG + Intronic