ID: 909519886

View in Genome Browser
Species Human (GRCh38)
Location 1:76555526-76555548
Sequence GGTCATTAATGTTCTCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909519881_909519886 14 Left 909519881 1:76555489-76555511 CCCAGGAAATGCTGACTGATCCA 0: 1
1: 0
2: 0
3: 21
4: 182
Right 909519886 1:76555526-76555548 GGTCATTAATGTTCTCCTAAAGG No data
909519884_909519886 -6 Left 909519884 1:76555509-76555531 CCAAACAAAGTGAACCTGGTCAT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 909519886 1:76555526-76555548 GGTCATTAATGTTCTCCTAAAGG No data
909519882_909519886 13 Left 909519882 1:76555490-76555512 CCAGGAAATGCTGACTGATCCAA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 909519886 1:76555526-76555548 GGTCATTAATGTTCTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909519886 Original CRISPR GGTCATTAATGTTCTCCTAA AGG Intronic
No off target data available for this crispr