ID: 909519888

View in Genome Browser
Species Human (GRCh38)
Location 1:76555549-76555571
Sequence TGAGATTTGAGATTCAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909519885_909519888 3 Left 909519885 1:76555523-76555545 CCTGGTCATTAATGTTCTCCTAA 0: 1
1: 0
2: 2
3: 11
4: 139
Right 909519888 1:76555549-76555571 TGAGATTTGAGATTCAAAGAAGG 0: 1
1: 1
2: 2
3: 29
4: 345
909519884_909519888 17 Left 909519884 1:76555509-76555531 CCAAACAAAGTGAACCTGGTCAT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 909519888 1:76555549-76555571 TGAGATTTGAGATTCAAAGAAGG 0: 1
1: 1
2: 2
3: 29
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909519888 Original CRISPR TGAGATTTGAGATTCAAAGA AGG Intronic
901334558 1:8437923-8437945 TGATATTTGAGATGCTATGAAGG + Intronic
902212740 1:14915406-14915428 TGTGATTTGAGAGACACAGAGGG - Intronic
902655748 1:17866824-17866846 TGAGAAATGAGGTTCAGAGAGGG - Intergenic
904962411 1:34344460-34344482 TAAGATATCAGAGTCAAAGATGG + Intergenic
904991857 1:34599419-34599441 CAACATTTGAGATACAAAGATGG - Intergenic
905325409 1:37148298-37148320 TGAGAAATGAGGTTCAGAGAAGG - Intergenic
905480124 1:38256159-38256181 TGAGACTTGTCATCCAAAGAGGG + Intergenic
906589819 1:47014409-47014431 AGGGATTTGAGAGTGAAAGAAGG - Intergenic
907285129 1:53375270-53375292 TAGGCTTTGAGATACAAAGATGG + Intergenic
907647579 1:56259572-56259594 ACAGATATGAGGTTCAAAGAGGG - Intergenic
908368425 1:63452942-63452964 TTAGCTTTTAGATTCAAACATGG - Intronic
908698828 1:66875567-66875589 TGAGAATTGAGTTTCACAGCTGG + Intronic
908946992 1:69510507-69510529 TGAGACTTCAGATTCCATGAAGG + Intergenic
909500798 1:76333028-76333050 GAAGACTTGAGATGCAAAGAGGG - Intronic
909519888 1:76555549-76555571 TGAGATTTGAGATTCAAAGAAGG + Intronic
909695828 1:78466541-78466563 GGAGATTTGTAATTCACAGAAGG + Intronic
911084813 1:93967619-93967641 TGAAGATTGAGTTTCAAAGAGGG + Intergenic
911150319 1:94592033-94592055 TCAGATTTTCCATTCAAAGATGG - Intergenic
911405075 1:97426981-97427003 AGAGATTTAAGATTCAGAGTTGG + Intronic
911815880 1:102350222-102350244 TGAGATTTATGATCAAAAGAGGG - Intergenic
911926907 1:103844281-103844303 TGAGTTTGGAGAGTCAGAGAGGG - Intergenic
913572426 1:120134043-120134065 GGACATTTGAGATTCAGACAGGG - Intergenic
914390631 1:147219026-147219048 TGATAATAGAGATTTAAAGAAGG - Intronic
914864563 1:151415759-151415781 TGAGATTTGGGACTAAAAAATGG - Intronic
917096098 1:171400352-171400374 TGAAAGTTGAGGTTCAGAGAAGG - Intergenic
918471838 1:184883345-184883367 TGGGAGTTGAAATTCAAACAGGG - Intronic
919872760 1:201835418-201835440 TGAGACTAGAGAATGAAAGAGGG + Intronic
920314344 1:205066700-205066722 TGAGCCTGGAGCTTCAAAGAGGG + Intronic
920774487 1:208922993-208923015 TGAGATTTGGAATACAGAGATGG + Intergenic
921317773 1:213908240-213908262 TGAGATTTGAGAGTCTTAAAAGG - Intergenic
921508508 1:216003679-216003701 TGATATTAGAGATTTAATGAGGG + Intronic
921917789 1:220632101-220632123 TAAGTTTTCATATTCAAAGATGG + Intronic
922063547 1:222114361-222114383 TGAGATTTGGGATGTAATGAGGG - Intergenic
922386331 1:225087554-225087576 TGAGAGTTGAGAAACAAACAAGG + Intronic
922547070 1:226465838-226465860 TTAGAGTTAAGATTCAAAAAAGG - Intergenic
923460988 1:234209277-234209299 TGAGATTTGAGTTTTTAAGTGGG + Intronic
923920299 1:238556434-238556456 TGAGATTTGATATTGGAAGTGGG - Intergenic
924591063 1:245404920-245404942 TGAGAATTCAGGTTCAAGGAAGG + Intronic
924841752 1:247717988-247718010 CAAAATATGAGATTCAAAGAAGG + Intergenic
1063247420 10:4236694-4236716 TGAAATTAGAGATTGAAAGATGG + Intergenic
1063320712 10:5050335-5050357 TGAAATTTTAAAATCAAAGAAGG + Intronic
1063407425 10:5810127-5810149 TGTGATTTCAGATTCAGAGAAGG - Intronic
1063508354 10:6622593-6622615 TGAAATTTGAGTGTCAGAGAAGG - Intergenic
1063657333 10:8005023-8005045 TGAGATTTAAAATTGAAAGGAGG - Intronic
1064491891 10:15866846-15866868 TGAAATATGAGAGTCAAAAATGG - Intergenic
1065272904 10:24054463-24054485 CAAGATTTGAGCTTCAAAGCAGG + Intronic
1066597653 10:37069131-37069153 TGAGATTGGAGAAGCAAAAAAGG - Intergenic
1067307788 10:45081210-45081232 TGAGATTTGAGAATTGAAGGCGG + Intergenic
1067452326 10:46389928-46389950 TGAGATTTCAGGCTCAAAGCAGG + Intronic
1067986906 10:51159178-51159200 TGAACATTGACATTCAAAGAGGG + Intronic
1071139995 10:82498322-82498344 TTAGAATTGAGATAAAAAGATGG + Intronic
1071331890 10:84568705-84568727 CGAAATATGAGACTCAAAGAAGG - Intergenic
1073590764 10:104755593-104755615 TGATACTTGAGTTTCTAAGATGG + Intronic
1073601727 10:104852615-104852637 TGACATTTTAGAAGCAAAGATGG - Intronic
1074328658 10:112479838-112479860 TAGAATATGAGATTCAAAGAAGG - Intronic
1074944753 10:118270627-118270649 TGAGAATAGAGAATCAAAGAGGG - Intergenic
1075775574 10:124983919-124983941 TGAGGTTTGTGATTTAAATATGG + Intronic
1077711989 11:4546341-4546363 GGATATTTGAGCTACAAAGAAGG + Intergenic
1079647023 11:22877600-22877622 TGAGCTTTGAGATTCTATGGAGG + Intergenic
1079966968 11:26991731-26991753 TAAGATTAGATATTCAGAGAAGG - Intergenic
1080276691 11:30511162-30511184 TGAGATTTGATAATGAAATAGGG + Intronic
1081752270 11:45519705-45519727 AGAGAACTGAGATTCAGAGAAGG - Intergenic
1083044719 11:59723738-59723760 TGAGATTTGGGATTCCAAAGTGG - Intronic
1083608500 11:63993333-63993355 TGAGAGTTGAGATTCACACTTGG + Intronic
1084172465 11:67407092-67407114 TGTGATTTGAGGCTCAAAAAGGG - Intronic
1084505367 11:69563448-69563470 TGGGATTTGAAATGCAAAGGAGG + Intergenic
1085892151 11:80593258-80593280 TGAGATTGGAGAAGCAAAAAGGG + Intergenic
1087342578 11:96926744-96926766 TTAGAATTGAGATTGAGAGAGGG - Intergenic
1087502982 11:98983239-98983261 TGAGATTAGAAATTAACAGAGGG + Intergenic
1088047958 11:105476558-105476580 TGAGACTTCAAATTAAAAGATGG + Intergenic
1088520486 11:110693033-110693055 TGAGAATGGATAATCAAAGAAGG + Intronic
1088765349 11:112970129-112970151 TGACATTTAAGATTTAAATATGG - Intronic
1088863911 11:113827989-113828011 TGTTACTTGAGTTTCAAAGAAGG + Intronic
1089000485 11:115047908-115047930 TGACATTTGAGATGTGAAGAAGG - Intergenic
1089894421 11:121914802-121914824 TGACATTTGAGAGTCAGAGTAGG + Intergenic
1090287071 11:125509213-125509235 CAAAATATGAGATTCAAAGAAGG + Intergenic
1090505014 11:127301737-127301759 TGACATTTGAGATCCTAAGGGGG + Intergenic
1090857781 11:130625327-130625349 TAAGATTGGAGATTAAAACAGGG - Intergenic
1092947797 12:13472816-13472838 TCAGAAATGAGATTCAAATATGG - Intergenic
1093124776 12:15315287-15315309 AGAGATTTGAGATTCAAGTAAGG + Intronic
1093354022 12:18140868-18140890 TGAGATCTGAGAAGAAAAGACGG + Intronic
1093480819 12:19602107-19602129 TTAGATTTTAGAATTAAAGATGG + Intronic
1095451441 12:42335222-42335244 TCAGGTTTGGGATTCAGAGAAGG - Intronic
1095542257 12:43324170-43324192 AGGGATTTGAGAATGAAAGAGGG - Intergenic
1098031136 12:66256077-66256099 TGGGATATGAGATAGAAAGATGG - Intergenic
1099251273 12:80257778-80257800 TCAGCTTTGACATTCATAGACGG - Intronic
1099408808 12:82297938-82297960 TGAGTTTTAAGATAAAAAGAAGG - Intronic
1099496639 12:83355410-83355432 AGGAATTTAAGATTCAAAGAAGG + Intergenic
1101180558 12:102212290-102212312 AGAGATTAGAGATGGAAAGAGGG - Intergenic
1101301023 12:103482162-103482184 ACAGATTTGAGATGCAAAAAAGG - Intronic
1101478991 12:105078575-105078597 AGAGATTTGAGCTGCATAGAGGG - Intronic
1102614398 12:114140401-114140423 GGAGATTTCAGATTCACTGATGG + Intergenic
1103400378 12:120639906-120639928 TGGGATTTGAGATTCAGATAAGG + Intergenic
1109073287 13:57798521-57798543 GGACATTTGAGATTAAAATAAGG - Intergenic
1109673822 13:65645766-65645788 TGAGATTTGAGATTCAGATTAGG - Intergenic
1109776995 13:67053785-67053807 TGAGATTTTTGCTTCAAACATGG - Intronic
1110032626 13:70635924-70635946 AGAAATGCGAGATTCAAAGAAGG - Intergenic
1111104633 13:83629406-83629428 TTAGGTTTGCCATTCAAAGACGG + Intergenic
1115256744 14:31410745-31410767 AGATATTTCAGATTCAAAGATGG - Intronic
1115922747 14:38394756-38394778 TGAGATTTAAAATTCAGAGAGGG + Intergenic
1116562210 14:46394916-46394938 TGAGATGTAAGTTTCAAAAATGG - Intergenic
1116566221 14:46447563-46447585 TGGGAATTGAAATACAAAGAAGG + Intergenic
1117760416 14:59021307-59021329 TGAGATTATATTTTCAAAGAAGG - Intergenic
1119977963 14:79046256-79046278 TTAGATTTGAGATACACAGTTGG + Intronic
1123804189 15:23854497-23854519 AGAGATATGGGATTCACAGAGGG + Intergenic
1125121865 15:36169457-36169479 TGAGATTTGTGCTTCCAAGATGG + Intergenic
1125760792 15:42094270-42094292 TGAGATTTGGGATGCAGAGTGGG - Intronic
1126047180 15:44653054-44653076 TTACATTTGAGAAACAAAGAAGG + Intronic
1126400536 15:48264464-48264486 TGAAATTTGAGATTAAGAGGAGG - Intronic
1126519658 15:49577812-49577834 TGATATTGGAAATTCAAAGATGG + Intronic
1126528371 15:49684369-49684391 TGATATTTGTGGTTCAATGAGGG + Intergenic
1127945733 15:63750160-63750182 TGAGATTTAAGATTAGAACAAGG + Intronic
1128004596 15:64226715-64226737 TGTGATTTAAGATAAAAAGATGG + Intronic
1128356198 15:66928522-66928544 GAAAATGTGAGATTCAAAGAAGG - Intergenic
1128646368 15:69381472-69381494 TGAGATTTGAGCTGCTAAAAGGG + Intronic
1129057379 15:72830463-72830485 TGATATCTGAGATTGAAATAAGG - Intergenic
1130616476 15:85413607-85413629 TGAAAGTAGAGATTCAGAGAGGG + Intronic
1130678829 15:85978597-85978619 AGAGTTTGGAGATTCACAGATGG + Intergenic
1130847498 15:87761076-87761098 AGAGATTTGAAATACACAGAAGG + Intergenic
1130921974 15:88354828-88354850 TGTGTTCTGGGATTCAAAGAGGG + Intergenic
1131247045 15:90803993-90804015 TGACACTGGAGATACAAAGATGG + Intronic
1131929521 15:97425100-97425122 ACAGAGTTGAGATTCAAACATGG + Intergenic
1132173319 15:99686326-99686348 TGAGATTTATGATTTAAGGAGGG + Intronic
1134335534 16:13296059-13296081 TGACAATTGAGATTAACAGAAGG - Intergenic
1137566122 16:49533469-49533491 TCTGATTTGAGTTTCAGAGAAGG - Intronic
1137586851 16:49668866-49668888 TGAGGTTTGTGACTCAGAGAGGG - Intronic
1139718618 16:68834518-68834540 TGAGAGTTGATATTAAAACATGG - Exonic
1141250180 16:82348771-82348793 ACTGATTTCAGATTCAAAGAAGG - Intergenic
1141679488 16:85535974-85535996 TAGGCTTTGGGATTCAAAGATGG + Intergenic
1142641262 17:1287143-1287165 TGGGAGTTGAGTTTCAAAGGAGG + Intronic
1142661729 17:1434892-1434914 TGAGATTTGTGTTTCACAGCAGG + Intronic
1143574120 17:7779914-7779936 TGTGATTTGAGTTTGAAACAAGG + Intronic
1144019052 17:11223808-11223830 TGACACTAGAGATACAAAGAGGG - Intergenic
1144208606 17:12996289-12996311 TGAGATTCAAGACTCAAGGAAGG + Intronic
1144663680 17:17087830-17087852 TGCGGCCTGAGATTCAAAGAAGG - Intronic
1147568105 17:41549929-41549951 TGAGAATTGAGGGTCAAAGTTGG + Intergenic
1147900394 17:43779609-43779631 TTAAATGTGACATTCAAAGAAGG + Intergenic
1148022580 17:44563093-44563115 AGAGTTTTGAGATTCTCAGATGG - Intergenic
1149927149 17:60712760-60712782 TAAAATATGAGACTCAAAGAAGG + Intronic
1150009687 17:61492304-61492326 TTAGATTTCAGATTCAGAAAAGG + Intergenic
1150566176 17:66342778-66342800 TGAAATTTCAGATTAAGAGATGG - Intronic
1150655219 17:67034727-67034749 TGAGAGGTGAGATTGGAAGAGGG - Intergenic
1150943781 17:69722564-69722586 TGGGATTTGAGAGTTAGAGAGGG + Intergenic
1151185296 17:72359759-72359781 TGGTTTTTGAGTTTCAAAGAAGG + Intergenic
1151517508 17:74605925-74605947 TTAGATTTGAGCTTGAAAGATGG + Intergenic
1155201240 18:23519691-23519713 TGAGATTTGACCTTGGAAGAAGG + Intronic
1155788206 18:29928992-29929014 GAAGATATGATATTCAAAGATGG + Intergenic
1156115041 18:33777591-33777613 TCAGATTAGGGATTGAAAGAAGG + Intergenic
1157221487 18:45831345-45831367 TGAGAGTTGACATTCAATGAGGG - Intronic
1157558413 18:48628807-48628829 TGAGATTTGAGAGAGAGAGAGGG - Intronic
1158723880 18:59950656-59950678 TGAGATTTCAGTTTCCATGAAGG - Intergenic
1158842639 18:61404684-61404706 TGAGAGCTGAGATACAGAGATGG + Intronic
1159199289 18:65163001-65163023 TGAGATGAGAGATAAAAAGAAGG - Intergenic
1163869060 19:19803019-19803041 TAAGATTTGAGATCCAGGGAGGG + Intronic
1163873494 19:19845778-19845800 AGAGATTTGAGATCCAGGGAGGG + Intergenic
1163901732 19:20107454-20107476 AGAGATTTGAGATCCAGGGAGGG - Intronic
1163917390 19:20253091-20253113 AGAGATTTGAGATCCAGGGAGGG - Intergenic
1163931175 19:20393471-20393493 AGAGATTTGAGATCCAGGGAGGG - Intergenic
1163936834 19:20453996-20454018 AGAGATTTGAGATCCAGGGAAGG - Intergenic
1163960004 19:20680574-20680596 AGAGATTTGAGATCCCAGGAGGG - Intronic
1163971114 19:20796031-20796053 AGAGATTTGAGATCCAGGGAGGG - Intronic
1164141255 19:22466502-22466524 AGAGCTTTGAGATCCAGAGAGGG - Intronic
1164865585 19:31601733-31601755 TGAAATATAAAATTCAAAGAAGG - Intergenic
1165038309 19:33050362-33050384 AGAAAATTGAGATACAAAGAAGG - Intronic
1166057942 19:40304662-40304684 CAATATATGAGATTCAAAGAAGG - Intergenic
1166858384 19:45794841-45794863 TGAGATATGAGATTGAAAAGAGG - Intergenic
1167043291 19:47035567-47035589 TGAGATTCAAGATACAAACAGGG - Intronic
1167675965 19:50885843-50885865 TCAGATTTGAGAAACAAATATGG - Intergenic
926558920 2:14393636-14393658 TGTGATTTGAGGCTCAGAGAGGG - Intergenic
926934334 2:18072211-18072233 AAAAATTTGGGATTCAAAGAGGG + Intronic
927581387 2:24252451-24252473 GGAGATTTGACTTTCACAGAAGG - Exonic
928635987 2:33247377-33247399 TGAGAGTTGAGATTTAAAACAGG + Intronic
929835277 2:45390824-45390846 TGAGATTTGGAGTTTAAAGAAGG - Intronic
930261096 2:49146971-49146993 TGAGAGATGAGATGCAAAAAAGG + Intronic
930459207 2:51649329-51649351 ACAGATTTGAGATTGAAAAATGG - Intergenic
931455783 2:62408895-62408917 TGAGGTCTGAGAATAAAAGAAGG + Intergenic
931811641 2:65859872-65859894 TGACATTTTAGAGTCAAAGTGGG + Intergenic
931924014 2:67051498-67051520 TGAGCTTTGAGTTTCCAGGAGGG + Intergenic
932104357 2:68929026-68929048 ACTGATTTGAGATTCAAATATGG - Intergenic
932452771 2:71825792-71825814 AGATATTTTAGATTCAAAGGTGG + Intergenic
932730572 2:74218878-74218900 TGAGAGTTCAGAAGCAAAGATGG - Intronic
933901937 2:86856300-86856322 TGAGATTTCAGAGTCTGAGAAGG - Intronic
934583783 2:95470293-95470315 TGAGATTAGATAGACAAAGAAGG - Intergenic
934595669 2:95606421-95606443 TGAGATTAGATAGACAAAGAAGG + Intergenic
934787106 2:97019068-97019090 TGAGATTAGAGAGACAAAGAAGG - Intergenic
935778606 2:106492965-106492987 TGAGATTTCAGAGTCTGAGAAGG + Intergenic
937868427 2:126770921-126770943 TGAGATCTGAGGTCCCAAGATGG + Intergenic
938213386 2:129487585-129487607 GGACATTGGAGATTCAAAGGGGG + Intergenic
938621682 2:133061532-133061554 AGAAAACTGAGATTCAAAGAAGG + Intronic
938795523 2:134715862-134715884 TGAGTTTAGAAATTCAAATATGG - Intronic
938953575 2:136278913-136278935 TCAGATCTGAAATTCAAAGCTGG - Intergenic
939727406 2:145739820-145739842 TGAGACATGAGACTCAAAGAAGG - Intergenic
941150410 2:161907621-161907643 CCAGATTTGAGGTTCAGAGAAGG + Intronic
942122423 2:172791462-172791484 TGAAATTAGAGATTCACAAAAGG + Intronic
943004151 2:182369099-182369121 TCAAATTTGAGATAGAAAGACGG - Intronic
943038618 2:182776312-182776334 ACAGATTAAAGATTCAAAGAGGG - Intronic
943094360 2:183410838-183410860 GGAGAGTTGAGAGTGAAAGAAGG - Intergenic
943242855 2:185408466-185408488 TGACATTGGAGATTCTAAAAGGG - Intergenic
944959080 2:204849155-204849177 TGAGATTTAAGAGTCAAATTTGG + Intronic
944963466 2:204902297-204902319 TGAGACTCGAGATTAAAATATGG + Intronic
945457886 2:210070192-210070214 AGAGATTTGAGACACAGAGAAGG - Intronic
946649888 2:221880775-221880797 TTTGATATGAGATTCAAACAGGG + Intergenic
948095421 2:235329757-235329779 TGAGTTCTGAGATTCTAGGATGG - Intergenic
948241888 2:236444846-236444868 AGAGATCTGACATTCAAAGATGG + Intronic
1168743104 20:211741-211763 TGAGATTTAACATTCATAGATGG - Intergenic
1169918633 20:10709304-10709326 TGAAATGTCAGATGCAAAGAGGG + Intergenic
1170065901 20:12310411-12310433 TGCAATTTGAGATTGATAGATGG + Intergenic
1172112689 20:32556610-32556632 CCAGAGTTGAGATTCACAGATGG - Intronic
1172744097 20:37193399-37193421 TTACATTTGAGATTGAAAGGAGG + Intronic
1173926075 20:46782358-46782380 TGAGCTTTGATATTCTATGAAGG - Intergenic
1177078365 21:16607175-16607197 TGAGATTAGAAGTTAAAAGAAGG - Intergenic
1178038915 21:28617321-28617343 TGAGACTGGAGATGCAAACAAGG + Intergenic
1178110656 21:29366967-29366989 TGAGATTTGATCTTCAATGTTGG + Intronic
1180248005 21:46561378-46561400 TGGGATCTGAGCTTCAAAGCTGG - Intronic
1182061000 22:27397363-27397385 TGAGCTTTGAGAATCAGAGTGGG - Intergenic
1182164106 22:28154947-28154969 TGAGATTTGAGTCACTAAGAAGG - Intronic
950442149 3:13016315-13016337 TGACAATTGAGACCCAAAGAAGG - Intronic
951727842 3:25780121-25780143 TGTAATTTGAGAATCACAGATGG + Intronic
952193560 3:31048667-31048689 GTAGAGTTGAGATTCAAAGCTGG - Intergenic
952610007 3:35197274-35197296 GGAAATTTGGGATACAAAGATGG + Intergenic
953217877 3:40938071-40938093 GGAAAACTGAGATTCAAAGAGGG + Intergenic
954745674 3:52786271-52786293 TGAGAGTTGAGGTACAGAGAGGG - Intronic
954763612 3:52895678-52895700 TGACACTTGTGATTCAGAGAAGG - Intronic
956062452 3:65361362-65361384 TGAGATTTGAAATTCATGTACGG + Intronic
957285631 3:78214038-78214060 TGAGATTTGAGATTTTTAAAAGG - Intergenic
957969037 3:87359827-87359849 GGAAATCTGAGAATCAAAGAAGG + Intergenic
958082071 3:88759592-88759614 AGAGATTTGAAAATCAAATATGG + Intergenic
958523312 3:95219825-95219847 ATACATTTTAGATTCAAAGAGGG - Intergenic
960430815 3:117566468-117566490 TGAGATTTGGGATGCTGAGAAGG - Intergenic
961070745 3:123923097-123923119 TTACATTTGAGATGCAAGGATGG + Intronic
962674855 3:137748140-137748162 TGAGATGTGAGATTAAAAGTGGG - Intergenic
964870741 3:161311503-161311525 TAGGAGTTGAGATTGAAAGAAGG + Intergenic
965961479 3:174433932-174433954 AGTCATTTTAGATTCAAAGACGG + Intergenic
966317790 3:178668090-178668112 TGAGCTTGCAAATTCAAAGAAGG - Intronic
970322506 4:14888661-14888683 GCAGATTTGGGATTCAAATACGG + Intergenic
970393207 4:15637148-15637170 TGAAATGTGAAAATCAAAGAGGG - Intronic
970774841 4:19661388-19661410 TGAGAATAGAGTTTCAAAAAAGG + Intergenic
973571963 4:52249838-52249860 AGAAATTTGAGATTCACACAGGG - Intergenic
974532409 4:63125981-63126003 ATAGATATGAGATTCAAAGTAGG - Intergenic
975057847 4:69957556-69957578 TGGGATTTGAGGGTCAAAAAAGG + Exonic
975391796 4:73827249-73827271 TAACATTTGTGATTCATAGAAGG - Intergenic
975496424 4:75040489-75040511 TGAGATTTTTGTTTAAAAGATGG + Intronic
975540958 4:75511945-75511967 TTGGAATTGAGATGCAAAGAGGG - Intronic
975554999 4:75653825-75653847 GGAGATTTGACATTTAAAGTGGG + Intronic
976806680 4:89055001-89055023 TCAAATATGAGATTCAAAGAAGG - Intronic
976958024 4:90928684-90928706 TGAGATTTGAGACTTAAAGAAGG + Intronic
977349060 4:95857367-95857389 CAACATTTGAGACTCAAAGAAGG + Intergenic
977646465 4:99417995-99418017 TGAGAACTGAGATTTAAAGCTGG - Intronic
980754582 4:137140960-137140982 TGAGATGTGGAATTCAGAGAAGG + Intergenic
980816793 4:137958213-137958235 TTAGTTTTGAAATACAAAGACGG - Intergenic
980883170 4:138734124-138734146 TTAGATTTCACATTCAGAGAAGG - Intergenic
981433780 4:144694815-144694837 AGAGATTTTAGCTTTAAAGATGG + Intronic
981492227 4:145352024-145352046 AGAAACCTGAGATTCAAAGAAGG + Intergenic
981595224 4:146413761-146413783 TCAGATTTGAGAGTCATATAAGG + Intronic
983146253 4:164218394-164218416 TGAGGTTAGAGAATAAAAGAAGG + Intronic
984240815 4:177217407-177217429 TGAAATATGCGACTCAAAGAAGG - Intergenic
984827398 4:183938745-183938767 TGAGCTTTGAAAATCAAAGTTGG - Intronic
985964222 5:3327570-3327592 TGAGCTCTGAGTTTCAGAGAAGG - Intergenic
987501614 5:18717796-18717818 TGGGATTAGAGAATTAAAGATGG - Intergenic
988105006 5:26733584-26733606 GGAGATCTGAGATACAGAGAAGG - Intergenic
989400126 5:40999785-40999807 AGAGATGTGAATTTCAAAGAGGG + Intronic
993864491 5:93176061-93176083 TCATATATGAGATTTAAAGAGGG - Intergenic
993921763 5:93813908-93813930 TGAAATTTGGGGTTCAAATAAGG + Intronic
994558976 5:101343139-101343161 TGAAATTTGACATTCACAGAAGG + Intergenic
994945566 5:106383896-106383918 TGAGATTTTATATTCCATGAAGG + Intergenic
994952798 5:106486497-106486519 TGAGATTTGTAATTCGCAGATGG - Intergenic
995350033 5:111164395-111164417 TGAAATTTGATATTCAAGGTTGG - Intergenic
995902747 5:117089537-117089559 TGATCTTTGGAATTCAAAGAAGG - Intergenic
995939851 5:117568781-117568803 TGGCATTTGAGATACACAGAGGG + Intergenic
995955983 5:117776822-117776844 TGAGATTTGACAACAAAAGAAGG - Intergenic
996147592 5:119994812-119994834 TTAGATTTGAGATTTCAGGAGGG + Intergenic
996972727 5:129392152-129392174 TAATATTTTAAATTCAAAGAAGG + Intergenic
997079450 5:130721588-130721610 TAAAATATGAGACTCAAAGAAGG + Intergenic
998302341 5:141036035-141036057 TGAGGCTTGAGATAGAAAGATGG - Intergenic
999976596 5:156917795-156917817 AGAGAGTTGAAATCCAAAGATGG + Intergenic
1000846572 5:166289156-166289178 TGAGATTTGAGAGAGCAAGAAGG + Intergenic
1007557712 6:42781097-42781119 TGAGATTTGAGATTAAAAATAGG + Intronic
1007963289 6:45980891-45980913 TGATCTTTGAGCTTCTAAGAAGG - Intronic
1008909283 6:56715944-56715966 TCAAATATGAGACTCAAAGAAGG - Intronic
1009036589 6:58124516-58124538 TAAGATATGAGACTCAAAGAAGG + Intergenic
1009212400 6:60878140-60878162 TAAGATATGAGACTCAAAGAAGG + Intergenic
1009475607 6:64087331-64087353 TTAGATTTTAGCTTCATAGAAGG + Intronic
1010284966 6:74066133-74066155 AGAGAATTAAGATCCAAAGAGGG + Intergenic
1010965094 6:82196244-82196266 TCAGATTTTAGATTTATAGATGG - Intronic
1011908557 6:92405302-92405324 TGAAATTTGACATTGAAATAGGG + Intergenic
1012207765 6:96482020-96482042 TGAGATTTGAAAGTCAAGCATGG + Intergenic
1012545753 6:100417593-100417615 TGAGAATTTAGAATCCAAGATGG + Intronic
1012589649 6:100965161-100965183 TGAGGATTAAGAGTCAAAGAAGG - Intergenic
1013608104 6:111769312-111769334 TAAGAATTGAAATTCAAATAGGG - Intronic
1013848073 6:114478721-114478743 AGATATTTGGGATACAAAGATGG + Intergenic
1014531594 6:122565382-122565404 TGAGCTTTGAAAATCAAAAAAGG - Intronic
1016149980 6:140728771-140728793 TGAAATTTGATCTTCAAAGTTGG + Intergenic
1016348891 6:143146278-143146300 TGAAATTTGAGATCAAAAAAAGG + Intronic
1017282339 6:152637948-152637970 TCAGATTGGAGATTCAAGGGGGG - Intergenic
1017306677 6:152926375-152926397 TGAGATATGAGATGCAATGGAGG + Intergenic
1020342173 7:7123921-7123943 TGAGATTAGAGATTGGAGGAAGG + Intergenic
1020697319 7:11429611-11429633 TCAGACTTGATTTTCAAAGAAGG - Intronic
1022246455 7:28564658-28564680 TGAGAAATGTGAATCAAAGAGGG + Intronic
1022291371 7:29007017-29007039 TGATATTTGAGGAACAAAGAGGG - Intronic
1023785082 7:43698345-43698367 TCACATTTGAGATTTAAAAAAGG - Intronic
1024182571 7:46910685-46910707 GGACATTTGAGCTACAAAGAGGG - Intergenic
1024406466 7:48987749-48987771 TGAGAATTTAGATGAAAAGATGG - Intergenic
1025142381 7:56476914-56476936 TTAGATTTGAGATTCAGGCAGGG - Intergenic
1025162053 7:56669761-56669783 TGAGAGTTGAGATGGGAAGAGGG + Intergenic
1025773923 7:64541557-64541579 AGAGCTTTGAGATCCAGAGAGGG + Intronic
1026888353 7:73967612-73967634 TGAGCTTCGAGATTCATGGAGGG + Intergenic
1027525857 7:79267765-79267787 CAAAATTTGAGACTCAAAGAGGG + Intronic
1028445663 7:90920499-90920521 AGAGAGATGAGATTCAGAGAGGG + Intronic
1028785834 7:94792508-94792530 TGAGAATAGAGAAACAAAGAAGG - Intergenic
1030537899 7:110791839-110791861 TGATAGTTGAGTTTCAGAGAAGG - Intronic
1030632865 7:111914476-111914498 TGGGAATGGAGATTCGAAGAGGG - Intronic
1030822865 7:114116880-114116902 TGGGACTTGAGATTCAGAGCAGG - Intronic
1030894579 7:115041605-115041627 TTAGATTTGAGATACAAAGATGG - Intergenic
1031137318 7:117899382-117899404 AGACATTACAGATTCAAAGAGGG + Intergenic
1031552424 7:123131666-123131688 AGAGATTTTAGATTGACAGACGG - Intronic
1031791574 7:126112601-126112623 TGACATCTGAGCTTCAAAGATGG + Intergenic
1032913309 7:136458942-136458964 TGATATTTGGGATTTGAAGATGG + Intergenic
1033176063 7:139124777-139124799 CAAAATATGAGATTCAAAGAAGG - Intergenic
1033526901 7:142225290-142225312 TGAGATTAGACATTCAAATGAGG + Intergenic
1033542134 7:142366854-142366876 TGAGATTTGAGAGAGAAAAAAGG - Intergenic
1033961932 7:146924411-146924433 TGTGATTTGTGAATCAGAGAGGG - Intronic
1035387034 7:158479991-158480013 TGGGATTCTAGATTCCAAGAAGG + Intronic
1035812306 8:2503002-2503024 TGAAATTTGAAATGCAAGGAGGG + Intergenic
1039465993 8:37785862-37785884 ACAGATTTGAGATTCAAAGCCGG - Intronic
1039727066 8:40229792-40229814 TAAAATATGAGACTCAAAGAAGG - Intergenic
1042398985 8:68324014-68324036 TGAAACTTGAGATTGAAATACGG - Intronic
1042577190 8:70233442-70233464 TGAATTTTGAGATTCAAATAAGG + Intronic
1042993741 8:74669761-74669783 TGACATTTGAGATCCAAGGGAGG - Intronic
1043655248 8:82656371-82656393 TGAGAGTTGTGATCTAAAGAAGG + Intergenic
1043760933 8:84067264-84067286 TTAGAGTTGAGATTGGAAGAAGG - Intergenic
1043826388 8:84934295-84934317 TGAGATTTGAGAGTCAAAGATGG - Intergenic
1043908447 8:85833354-85833376 TGAGATTTTATCTTCAAAAAAGG - Intergenic
1044863858 8:96550324-96550346 TCAGATTTGAGATTCTCAGCTGG + Intronic
1046756252 8:117975543-117975565 TCAGATTGGAGATTCAGAGAAGG - Intronic
1046841794 8:118866813-118866835 AGAAATTTGAGAGTCAATGAAGG - Intergenic
1047540485 8:125760514-125760536 TGTGAATTGGGATGCAAAGAAGG - Intergenic
1047625928 8:126656139-126656161 TGAGATATGGGATTGAATGAGGG + Intergenic
1048155121 8:131940086-131940108 TGAGAGTTAAGATCCAAAGGAGG + Intronic
1048163942 8:132045481-132045503 TGAGCTCTGAGCTTCCAAGAAGG - Intronic
1048321671 8:133405075-133405097 GGAGATTTGAGGCACAAAGAGGG - Intergenic
1048864692 8:138751094-138751116 TGAGATATGATATTCAATAATGG + Intronic
1049867501 8:144948324-144948346 TGGGAGATGAGATTCAAAGCAGG + Intronic
1051095692 9:13463207-13463229 TGCGATGTGAGAATCAAGGAGGG - Intergenic
1051602241 9:18886833-18886855 TGAGATACGAGACACAAAGATGG - Intronic
1052784379 9:32815004-32815026 ACAGATATGAGACTCAAAGAAGG - Intergenic
1055096144 9:72416226-72416248 TGAGATTTGAAAGGCTAAGAAGG - Intergenic
1055102813 9:72482666-72482688 TTCGATTTGAGATTCAGATAGGG - Intergenic
1055317372 9:75047660-75047682 GGAGAGTTGGGATTGAAAGATGG + Intergenic
1057548091 9:96032812-96032834 TGAGATTTGACCTACAAACAAGG - Intergenic
1057720667 9:97529274-97529296 GGAAAATTGAGATCCAAAGAAGG - Intronic
1057969500 9:99540633-99540655 TGGGATTTGAGGTTCAATAATGG - Intergenic
1058179740 9:101782259-101782281 TGAAATTTGAAACTCAATGAAGG - Intergenic
1058459052 9:105165951-105165973 TGGGATTTATTATTCAAAGAAGG + Intergenic
1059797351 9:117713164-117713186 AGAGATTTGAGTTTCAATGTGGG - Exonic
1059893886 9:118837438-118837460 AGAGAAATGAGATTCAGAGAGGG - Intergenic
1060893110 9:127201052-127201074 TGAGATTAGAGCTTCTAGGAAGG + Intronic
1062106552 9:134758063-134758085 TGAGATTGTAGATGCAAAGTGGG + Intronic
1186235242 X:7500962-7500984 TGAAATTTGACATTCAAAGCAGG + Intergenic
1187891515 X:23940346-23940368 TGTCATTTGATATTCAAAAATGG + Intergenic
1187997527 X:24944516-24944538 TGATATTTCAGGTTGAAAGAAGG - Intronic
1188011051 X:25056446-25056468 AGAGATTTTAGATACAATGAGGG - Intergenic
1188254044 X:27937263-27937285 TGAGATTTGAGAAACCAATATGG + Intergenic
1188488818 X:30714041-30714063 TTAAATATGAGCTTCAAAGAGGG + Intronic
1188678409 X:32971874-32971896 AGAGGTTTGAGATTCACAAAAGG + Intronic
1190433976 X:50405288-50405310 ACAGTTTTGAGATTGAAAGAAGG + Intronic
1191863387 X:65684340-65684362 TCGGATTTGACATTAAAAGATGG - Intronic
1192564670 X:72153777-72153799 TGAGATTTGACTCTCAAATATGG - Intergenic
1194645995 X:96458913-96458935 TGAGCTTTGAGGTTCAAACTGGG + Intergenic
1194960135 X:100225449-100225471 TGTGATTTGAGATACACAGCTGG - Intergenic
1194960213 X:100226502-100226524 TGTGATTTGAGATACACAGCTGG - Intergenic
1196197720 X:112853658-112853680 TGAGCTTTGAGTATCAAAGAAGG + Intergenic
1196753399 X:119137485-119137507 TGAGAACTGAGGTCCAAAGAGGG - Intronic
1196765664 X:119240190-119240212 TGGAATTTGATATTCAAAAATGG + Intronic
1197582933 X:128307985-128308007 TGAGATGTGTGATACATAGAGGG + Intergenic
1197743750 X:129916271-129916293 TGAGACTGGAGCTTCAAAGAAGG - Intronic
1199029855 X:142984722-142984744 TGACCTTTTAAATTCAAAGAAGG - Intergenic
1200713524 Y:6511338-6511360 TGTCATTTGAGATTCAAATTTGG - Intergenic
1201020404 Y:9650703-9650725 TGTCATTTGAGATTCAAATTTGG + Intergenic